Признания богатое: Компанию самого богатого экс-депутата Волгоградской облдумы могут признать несостоятельной

Содержание

Ложные признания — смотреть спектакль в театре имени А.С. Пушкина

Длительность

01:40

Премьера

29.08.2020

Аннотация

В дом богатой вдовы Араминты поступает на службу молодой адвокат Дорант — он беден, но хорош собой и решительно настроен завоевать сердце женщины. Дядя Доранта, не подозревающий о желаниях юноши, хочет женить его на деловитой компаньонке Мартон. А мать Араминты мечтает выдать дочь за аристократа. Что движет героями — корысть или искренние чувства? И сможет ли любовь распутать клубок неловких недоразумений, смешной путаницы и ложных признаний?.

.

Спектакль создан при содействии Фонда развития и поддержки социально-культурных проектов «Р.А.Фонд»

Авторы

В ролях

  • Весь состав

  • 05 Мар

  • 06 Мар

Госпожа Аргант

Господин Реми

Упоминания в СМИ

Великолепная пятёрка 3 сезон 63 серия Сериал (2021) 5 канал смотреть онлайн

Великолепная пятёрка 3 сезон 63 серия Сериал (2021) 5 канал смотреть онлайн

Sidenamn:

Innhald rikt tekstformat.

«Великолепная пятерка» – российский детектив о честных и доблестных стражах правопорядка. Поклонники отечественных многосерийных фильмов интересуются, когда выйдет 4 сезон Великолепная пятерка. Разработчики еще умалчивают данный факт. Но нам уже известна приблизительная дата выхода 4 сезона сериала Великолепная пятерка. Сюжет сериала Великолепная пятерка 4 сезон Есть пять человек в одном округе в провинции Санкт-Петербурга заслуживают уважения, но они также заслуживают признания. Эти люди, проработавшие не один год, уже доказали, что даже очень долгое время все знали об их профессионализме и настойчивости в той или иной ситуации. Кадр из сериала «Великолепная пятерка» Клиенты всегда разные для сотрудников правоохранительных органов другие, те, кто связывает свою жизнь с этим видом деятельности, знают, насколько ценно время. Потерянная минута, неправильный шаг, может сыграть против команды. Это известно тем, кто оказался в центре внимания, тем, кто является главными героями Петровского районного полицейского управления.
Павел первые пять лет не служил в майорах и получил большое признание. Дмитрий уже лейтенант и также находится в хорошем списке. Среди персонажей есть те, кто недавно на службе. Год или два они храбро демонстрировали свою честь и достоинство в исполнении. Не говоря уже о самом Голованове, это было бы смешно, ведь этот член их команды обладает самым талантливым чувством юмора. Когда будет 4 сезон Великолепная пятерка, тогда телезритель узнает, что ждет главных героев в новых серия Сериал (2021)х. Впереди много расследований, которые можно разобрать только сообща. Главные герои Бубнов (Нодар Джанелидзе) – капитан и опер. Ветров (Константин Гришанов) – старший лейтенант и оперуполномоченный. Голованов (Павел Григорьев) – подполковник и начальник отдела. Красавченко (Алексей Красноцветов) – капитан и старший оперуполномоченный. Кузьмин (Егор Кутенков) – лейтенант и программист. Шапошников (Андрей Горбачев) – майор и заместитель начальника отдела. Что показали в 3 сезоне Кадр из сериала «Великолепная пятерка» Технологический прогресс не стоит на месте, человеческие страсти продолжают бурлить и кипеть.
Некоторых из нас одолевают зависть, чувство мести, страх, корысть… . Это заставляет совершать необдуманные поступки, приводящие к непоправимым последствиям. У каждого сотрудника свой характер. Голованов специально подобрал разнобоких оперов, которые смогут стать лучшей командой. К командира богатое прошлое и невероятное чувство юмора, что помогает ему выйти из любой ситуации. Он периодически вспоминает те далекие события, происходящие на улицах Питера с разбитыми фонарями. Время теперь другое: город улучшили, власть поменялась, но человеческие натуры остались прежними. Одни люди порождают зло из-за ненависти и зависти, другие – которые имеют совесть и честь – отстаивают справедливость, противостоя злу.

 

rich_text    

Avbryt Førehandsvising Lagre side

Avbryt Hald fram med å slette Lagre side

[{:section_type=>»rich_text», :content=>»<p><a href=\»http://www. napublic.com/news/velikolepnaja_pjatjorka/2019-07-01-18390\» data-cke-saved-href=\»http://www.napublic.com/news/velikolepnaja_pjatjorka/2019-07-01-18390\»><img src=\»https://support.wolf-studios.com/hc/user_images/Hrit896pT1rjAk-rleCG4g.jpeg\» alt=\»\» data-cke-saved-src=\»https://support.wolf-studios.com/hc/user_images/Hrit896pT1rjAk-rleCG4g.jpeg\»></a></p>\n<table style=\»border-collapse: collapse; width: 254pt;\» width=\»339\»>\n<colgroup>\n<col style=\»width: 254pt;\» width=\»339\»> </colgroup>\n<tbody>\n<tr style=\»height: 20.25pt;\»>\n<td style=\»width: 254pt; height: 20.25pt;\» width=\»339\»>«Великолепная пятерка» – российский детектив о честных и доблестных стражах правопорядка. Поклонники отечественных многосерийных фильмов интересуются, когда выйдет 4 сезон Великолепная пятерка. Разработчики еще умалчивают данный факт. Но нам уже известна приблизительная дата выхода 4 сезона сериала Великолепная пятерка. Сюжет сериала Великолепная пятерка 4 сезон Есть пять человек в одном округе в провинции Санкт-Петербурга заслуживают уважения, но они также заслуживают признания.
Эти люди, проработавшие не один год, уже доказали, что даже очень долгое время все знали об их профессионализме и настойчивости в той или иной ситуации. Кадр из сериала «Великолепная пятерка» Клиенты всегда разные для сотрудников правоохранительных органов другие, те, кто связывает свою жизнь с этим видом деятельности, знают, насколько ценно время. Потерянная минута, неправильный шаг, может сыграть против команды. Это известно тем, кто оказался в центре внимания, тем, кто является главными героями Петровского районного полицейского управления. Павел первые пять лет не служил в майорах и получил большое признание. Дмитрий уже лейтенант и также находится в хорошем списке. Среди персонажей есть те, кто недавно на службе. Год или два они храбро демонстрировали свою честь и достоинство в исполнении. Не говоря уже о самом Голованове, это было бы смешно, ведь этот член их команды обладает самым талантливым чувством юмора. Когда будет 4 сезон Великолепная пятерка, тогда телезритель узнает, что ждет главных героев в новых серия Сериал (2021)х.
Впереди много расследований, которые можно разобрать только сообща. Главные герои Бубнов (Нодар Джанелидзе) – капитан и опер. Ветров (Константин Гришанов) – старший лейтенант и оперуполномоченный. Голованов (Павел Григорьев) – подполковник и начальник отдела. Красавченко (Алексей Красноцветов) – капитан и старший оперуполномоченный. Кузьмин (Егор Кутенков) – лейтенант и программист. Шапошников (Андрей Горбачев) – майор и заместитель начальника отдела. Что показали в 3 сезоне Кадр из сериала «Великолепная пятерка» Технологический прогресс не стоит на месте, человеческие страсти продолжают бурлить и кипеть. Некоторых из нас одолевают зависть, чувство мести, страх, корысть… . Это заставляет совершать необдуманные поступки, приводящие к непоправимым последствиям. У каждого сотрудника свой характер. Голованов специально подобрал разнобоких оперов, которые смогут стать лучшей командой. К командира богатое прошлое и невероятное чувство юмора, что помогает ему выйти из любой ситуации. Он периодически вспоминает те далекие события, происходящие на улицах Питера с разбитыми фонарями.
Время теперь другое: город улучшили, власть поменялась, но человеческие натуры остались прежними. Одни люди порождают зло из-за ненависти и зависти, другие – которые имеют совесть и честь – отстаивают справедливость, противостоя злу.</td>\n</tr>\n</tbody>\n</table>\n<p> </p>»}]

Innhald rikt tekstformat.

rich_text    

Самой богатой семьей России признаны братья Ананьевы

Самой богатой семьей России признаны братья Ананьевы, потеснившие в этом году семью Гуцериевых. Петербургские семьи занимают третье и четвертое места в рейтинге.

Рейтинг самых богатых семей России во второй раз опубликовал журнал «Финанс». На первом месте оказались братья Ананьевы, чей капитал журналисты оценили в $6,5 млрд. Братья контролируют Промсвязьбанк и «Промсвязькапитал».

Из-за обвала бирж богатейшие люди мира за день лишились $11,3 млрд Новости

Из-за обвала бирж богатейшие люди мира за день лишились $11,3 млрд

Год назад Ананьевы занимали второе место, уступая семье Гуцериевых, чьи основные активы — это «Русснефть» и Бинбанк. Теперь же Гуцериевы заняли второе место с $5,8 млрд.

На третьем месте братья Ротенберг, контролирующие компании «Стройгазмонтаж», СМП–банк и «Мостотрест». Их состояние оценено в $3,5 млрд. Ротенберги в этом году подвинули на четвертое место других петербургских предпринимателей — Андрея Молчанова и его дядю Михаила Романова, которые контролируют «Группу ЛСР».

Ротенберги и Молчановы оказались в списке самыми богатыми семьями из Петербурга. Следующие по списку петербуржцы находятся только на 19–м месте. Это Вячеслав Заренков и его сын Дмитрий, которым принадлежит группа «Эталон». А еще ниже, на 24–м месте, — семья Мирилашвили, чьи крупнейшие активы — группа «Конти», «Петромир», «Вконтакте» и «Евросервис».

Семейные бизнесы растут быстрее, чем капиталы отдельных миллиардеров, делает вывод «Финанс». Если совокупный капитал рейтинга миллиардеров увеличился за год на 34%, то суммарный капитал семей — в полтора раза.

Всего в список самых богатых семей попали 124 человека. Из них 77 человек были в нем и в прошлом году. 19 фамилий обладают состоянием, размер которого превышает $1 млрд.

Выделите фрагмент с текстом ошибки и нажмите Ctrl+Enter

Какой сегодня праздник: 15 января

СИМФЕРОПОЛЬ, 15 янв – РИА Новости Крым. 15 января в России — День образования следственного комитета, в Хорватии — День международного признания, а в Иордании — национальный День дерева. Также в этот день родились французский драматург Жан-Батист Мольер, русский писатель Александр Грибоедов и автомобилестроитель Жан Бугатти.

Что празднуют в России

День образования Следственного комитета России — относительно молодой праздник. Он был установлен 15 января 2011 года после принятия Федерального закона «О Следственном комитете РФ». А идея создать отдельное ведомство пришла из Петровских времен, когда император Петр разделил уголовный процесс на две стадии: предварительное расследование и судебное разбирательство.

Чем дата важна для других стран

15 января в Хорватии отмечается как День международного признания страны. В этот день в 1992 году Республику Хорватию, тогда еще одну из югославских республик, признали 12 стран Европейского союза. 22 мая 1992 года молодая признанная страна стала членом ООН.

У иорданцев начинается благотворительный и полезный труд – высадка пальм и олив. В стране — Праздник дерева. Территория Иордании на 90% — это пустынные плато, где тень для отдыха и укрытие от знойного солнца можно найти лишь на аллеях в парках. Кроме того, пальма в Иордании считается символом жизни и почитается как священное дерево. 

Знаменательные события

В 1831 году промышленник с Урала Павел Демидов в качестве поощрения за труд и вклад в развитие науки учредил ежегодную премию «для содействия к преуспеванию наук».

В 1943 году завершилось строительство здания Министерства обороны США — Пентагона. Здание в форме правильного пятиугольника находится в штате Вирджиния недалеко от Вашингтона.

В 1955 году китайское руководство приняло решение о разработке и создании собственного ядерного арсенала. Первое испытание атомной бомбы в Китае прошло в 1964 году.

В 2001 году начал работу сайт «Википедии» — интернет-энциклопедии со свободным контентом. Название образовано при помощи гавайского слова «wiki» («быстро»), присоединенному к привычному слову «энциклопедия».

Кто родился 

15 января 1622 года родился французский драматург-комедиограф Жан-Батист Мольер. Получив юридическое образование в Клермонском колледже, он решил посвятить себя театру и драматургии. Мольер оставил богатое наследие: «Школа жен», «Школа мужей», «Тартюф», «Дон Жуан», «Мещанин во дворянстве», «Проделки Скапена». Его пьесы до сих пор пользуются успехом на театральных подмостках.

225 лет назад, в 1795 году на свет появился русский дипломат и писатель Александр Грибоедов. Он писал стихи, статьи, пьесы и был автором 30 литературных и публицистических произведений. Самое известное — «Горе от ума». Кроме того, Грибоедов как представитель императорского двора нес дипломатическую миссию в Турции и Персии, где и трагически погиб при нападении на дипмиссию религиозного фанатика.

15 января 1909 года в Кельне в семье известного автомобилестроителя Этторе Бугатти родился сын, которого назвали Жанберто (на французский манер — Жан). Его отец был выходцем из Италии, основавшим знаменитую французскую компанию Automobiles Ettore Bugatti. Красоте и скорости Жан Бугатти посвятил свою короткую жизнь — при его участии, а потом и под его руководством появились на свет легендарные автомобили Bugatti Type 50, Bugatti Type 41 Royale и, конечно, Bugatti Atlantic.  

В 1929 году в Атланте, США, родился Мартин Лютер Кинг – афроамериканский борец против расовой дискриминации. Кинг был священником баптистской церкви, а в 1955 году присоединился к акциям борьбы за права чернокожих. За участие в ненасильственной борьбе против расовой дискриминации он получил Нобелевскую премию мира.

Также 15 января родились Герои Советского Союза офицер-подводник Александр Маринеско и маршал Василий Петров. Свои дни рождения отмечают также композитор Максим Дунаевский, кинорежиссер Егор Кончаловский, актриса Екатерина Волкова и другие.

Шарапова, Лепс и Шнуров признаны самыми богатыми и знаменитыми – Москва 24, 21.07.2016

Фото: ТАСС

Теннисистка Мария Шарапова возглавила составленный журналом Forbes рейтинг 50-ти главных российских знаменитостей в сезоне 2015/2016. При составлении списка самых богатых и знаменитых учитывались как заработок звезд, так и число упоминаний в СМИ и запросов в поисковых системах.

Мария Шарапова, которую в этом году отстранили от спортивных состязаний после допинг-скандала, в 2015-2016 годах заработала на спорте и рекламе, по данным Forbes, 21,9 миллиона долларов. При этом имя знаменитой теннисистки упоминалось в СМИ 12 760 раз, а в поисковом сервисе «Яндекс» – 879 766 раз. Как пишет издание, мельдониевый скандал пока не отразился на доходах спортсменки, однако ряд компаний (например, TAG Heuer, Porsche и American Express) уже разорвали с ней рекламные контракты.

Второе и третье место заняли представители музыкальной индустрии Григорий Лепс и Сергей Шнуров. Доход первого составил 9 миллионов долларов, а заработок второго — 11 миллионов долларов. Лепс получил «серебро», несмотря на то что заработал меньше лидера группы «Ленинград», поскольку его имя немного чаще мелькало в СМИ и запрашивалось в поисковике.

В десятку самых богатых и знаменитых россиян также попали Филипп Киркоров (7,6 миллиона долларов), хоккеисты Александр Овечкин и Евгений Малкин (12,1 и 9,9 миллиона долларов соответственно), а также модель Наталья Водянова (7 миллионов долларов), которая недавно стала мамой в пятый раз, Сергей Лазарев (1,3 миллиона долларов), Егор Крид (3,6 миллиона долларов) и Земфира (6 миллионов долларов).

Так или иначе в рейтинге засветились практически все российские селебрити, чьи имена были на слуху последние несколько месяцев. Список не обошелся без актеров Дмитрия Нагиева и Константина Хабенского, музыкантов Дениса Мацуева и Валерия Гергиева, режиссера Никиты Михалков, телеведущего Ивана Урганта и художественного руководителя МХТ имени Чехова Олега Табакова.

Всего же 50 упомянутых в рейтинге знаменитостей заработали 164 миллиона долларов против 174 миллионов, заработанных звездами в совокупности в минувшем году.

Декларация принципов терпимости — Декларации — Декларации, конвенции, соглашения и другие правовые материалы

Декларация принципов терпимости

Принята резолюцией 5.61 Генеральной конференции ЮНЕСКО от 16 ноября 1995 года

Государства — члены Организации Объединенных Наций по вопросам образования, науки и культуры, собравшиеся в Париже на двадцать восьмую сессию Генеральной конференции 25 октября — 16 ноября 1995 года,

Преамбула

памятуя о том, что Устав Организации Объединенных Наций гласит: «Мы, народы Объединенных Наций, преисполненные решимости избавить грядущие поколения от бедствий войны . .. вновь утвердить веру в основные права человека, в достоинство и ценность человеческой личности … и в этих целях проявлять терпимость и жить вместе, в мире друг с другом, как добрые соседи»,

напоминая, что в Преамбуле Устава ЮНЕСКО, принятого 16 ноября 1945 года, подчеркивается, что «мир должен базироваться на интеллектуальной и нравственной солидарности человечества»,

напоминая также, что во Всеобщей декларации прав человека провозглашается, что «каждый человек имеет право на свободу мысли, совести и религии» (статья 18), «на свободу убеждений и на свободное выражение их» (статья 19) и что образование «должно содействовать взаимопониманию, терпимости и дружбе между всеми народами, расовыми и религиозными группами» (статья 26),

принимая во внимание соответствующие международные акты, в том числе:

  • Международный пакт о гражданских и политических правах,
  • Международный пакт об экономических, социальных и культурных правах,
  • Международную конвенцию о ликвидации всех форм расовой дискриминации,
  • Конвенцию о предупреждении преступления геноцида и наказании за него,
  • Конвенцию о правах ребенка,
  • Конвенцию 1951 года о статусе беженцев и Протокол 1967 года, касающийся статуса беженцев, а также региональные правовые акты в этой области,
  • Конвенцию о ликвидации всех форм дискриминации в отношении женщин,
  • Конвенцию против пыток и других жестоких, бесчеловечных и унижающих достоинство видов обращения и наказания,
  • Декларацию о ликвидации всех форм нетерпимости и дискриминации на основе религии или убеждений,
  • Декларацию о правах лиц, принадлежащих к национальным или этническим, религиозным и языковым меньшинствам,
  • Декларацию о мерах по ликвидации международного терроризма,
  • Венскую декларацию и Программу действий Всемирной конференции по правам человека,
  • Декларацию и Программу действий, принятые на Всемирной встрече на высшем уровне в интересах социального развития, состоявшейся в Копенгагене,
  • Декларацию ЮНЕСКО о расе и расовых предрассудках,
  • Конвенцию и Рекомендацию ЮНЕСКО о борьбе с дискриминацией в области образования,

памятуя о целях третьего Десятилетия действий по борьбе против расизма и расовой дискриминации, Десятилетия образования в области прав человека Организации Объединенных Наций и Международного десятилетия коренных народов мира,

учитывая рекомендации региональных конференций, проведенных в соответствии с резолюцией 27 C/5. 14 Генеральной конференции ЮНЕСКО в рамках Года Организации Объединенных Наций, посвященного терпимости, а также выводы и рекомендации других конференций и совещаний, организованных государствами-членами по программе Года Организации Объединенных Наций, посвященного терпимости,

испытывая чувство тревоги в связи с участившимися в последнее время актами нетерпимости, насилия, терроризма, ксенофобии, агрессивного национализма, расизма, антисемитизма, отчуждения, маргинализации и дискриминации по отношению к национальным, этническим, религиозным и языковым меньшинствам, беженцам, рабочим-мигрантам, иммигрантам и социально наименее защищенным группам в обществах, а также актами насилия и запугивания в отношении отдельных лиц, осуществляющих свое право на свободу мнений и выражение убеждений, представляющими угрозу делу укрепления мира и демократии на национальном и международном уровнях и являющимися препятствиями на пути развития,

обращая особое внимание на обязанность государств-членов развивать и поощрять уважение прав человека и основных свобод для всех, без различия по признаку расы, пола, языка, национальной принадлежности, религии или состояния здоровья, и бороться с проявлениями нетерпимости,

принимают и торжественно провозглашают настоящую 
Декларацию принципов терпимости

преисполненные решимости сделать все необходимое для утверждения идеалов терпимости в наших обществах, поскольку терпимость является не только важнейшим принципом, но и необходимым условием мира и социально-экономического развития всех народов,

мы заявляем следующее:

Статья 1 — Понятие терпимости

1. 1  Терпимость означает уважение, принятие и правильное понимание богатого многообразия культур нашего мира, наших форм самовыражения и способов проявлений человеческой индивидуальности. Ей способствуют знания, открытость, общение и свобода мысли, совести и убеждений. Терпимость — это гармония в многообразии. Это не только моральный долг, но и политическая и правовая потребность. Терпимость — это добродетель, которая делает возможным достижение мира и способствует замене культуры войны культурой мира.

1.2 Терпимость — это не уступка, снисхождение или потворство. Терпимость — это прежде всего активное отношение, формируемое на основе признания универсальных прав и основных свобод человека. Ни при каких обстоятельствах терпимость не может служить оправданием посягательств на эти основные ценности, терпимость должны проявлять отдельные люди, группы и государства.

1.3 Терпимость — это обязанность способствовать утверждению прав человека, плюрализма (в том числе культурного плюрализма), демократии и правопорядка. Терпимость — это понятие, означающее отказ от догматизма, от абсолютизации истины и утверждающее нормы, установленные в международных правовых актах в области прав человека.

1.4 Проявление терпимости, которое созвучно уважению прав человека, не означает терпимого отношения к социальной несправедливости, отказа от своих или уступки чужим убеждениям. Это означает, что каждый свободен придерживаться своих убеждений и признает такое же право за другими. Это означает признание того, что люди по своей природе различаются по внешнему виду, положению, речи, поведению и ценностям и обладают правом жить в мире и сохранять свою индивидуальность. Это также означает, что взгляды одного человека не могут быть навязаны другим.

Статья 2 — Государственный уровень

2.1 На государственном уровне терпимость требует справедливого и беспристрастного законодательства, соблюдения правопорядка и судебно-процессуальных и административных норм. Терпимость также требует предоставления каждому человеку возможностей для экономического и социального развития без какой-либо дискриминации. Отчуждение и маргинализация могут стать причиной состояния подавленности, враждебности и фанатизма.

2.2 Для того чтобы сделать общество более терпимым, государствам следует ратифицировать существующие международные конвенции о правах человека и, если это необходимо, разработать новое законодательство с целью обеспечения в обществе равноправного подхода и равенства возможностей для всех групп и отдельных людей.

2.3 В интересах международного согласия существенно важно, чтобы отдельные люди, общины и нации признавали и уважали культурный плюрализм человеческого сообщества. Мир невозможен без терпимости, а развитие и демократия невозможны без мира.

2.4 Нетерпимость может принимать форму маргинализации социально наименее защищенных групп, их исключения из общественной и политической жизни, а также насилия и дискриминации по отношению к ним. Как гласит Декларация о расе и расовых предрассудках, «все люди и группы людей имеют право отличаться друг от друга» (статья 1. 2).

Статья 3 — Социальные аспекты

3.1 Терпимость как никогда ранее важна в современном мире. Мы живем в век глобализации экономики и все большей мобильности, быстрого развития коммуникации, интеграции и взаимозависимости, в век крупномасштабных миграций и перемещения населения, урбанизации и преобразования социальных структур. Каждый регион многолик, и поэтому эскалация нетерпимости и конфликтов потенциально угрожает всем частям мира. От такой угрозы нельзя отгородиться национальными границами, ибо она носит глобальный характер.

3.2 Терпимость необходима в отношениях как между отдельными людьми, так и на уровне семьи и общины. В школах и университетах, в рамках неформального образования, дома и на работе необходимо укреплять дух терпимости и формировать отношения открытости, внимания друг к другу и солидарности. Средства коммуникации способны играть конструктивную роль в деле содействия свободному и открытому диалогу и обсуждению, распространения ценностей терпимости и разъяснения опасности проявления безразличия по отношению к набирающим силу группам и идеологиям, проповедующим нетерпимость.

3.3 В Декларации ЮНЕСКО о расе и расовых предрассудках провозглашается, что особые меры должны приниматься в целях обеспечения равенства в достоинстве и правах отдельных лиц и групп людей везде, где это необходимо. В этой связи особое внимание следует уделять социально наименее защищенным группам, находящимся в неблагоприятных социальных или экономических условиях, с тем чтобы предоставить им правовую и социальную защиту, в частности в отношении жилья, занятости и охраны здоровья, обеспечить уважение самобытности их культуры и ценностей и содействовать, в особенности посредством образования, их социальному и профессиональному росту и интеграции.

3.4 В интересах решения этой глобальной задачи необходимы проведение соответствующих научных исследований и налаживание контактов с целью координации деятельности международного сообщества, включая анализ в контексте социальных наук коренных причин этого явления, принятие эффективных контрмер, а также осуществление научных исследований и мониторинга, способствующих выработке политических решений и нормативной деятельности государств-членов.

Статья 4 — Воспитание

4.1 Воспитание является наиболее эффективным средством предупреждения нетерпимости. Воспитание в духе терпимости начинается с обучения людей тому, в чем заключаются их общие права и свободы, дабы обеспечить осуществление этих прав, и с поощрения стремления к защите прав других.

4.2 Воспитание в духе терпимости следует рассматривать в качестве безотлагательного императива; в связи с этим необходимо поощрять методы систематического и рационального обучения терпимости, вскрывающие культурные, социальные, экономические, политические и религиозные источники нетерпимости, лежащие в основе насилия и отчуждения. Политика и программы в области образования должны способствовать улучшению взаимопонимания, укреплению солидарности и терпимости в отношениях как между отдельными людьми, так и между этническими, социальными, культурными, религиозными и языковыми группами, а также нациями.

4.3 Воспитание в духе терпимости должно быть направлено на противодействие влиянию, вызывающему чувство страха и отчуждения по отношению к другим. Оно должно способствовать формированию у молодежи навыков независимого мышления, критического осмысления и выработки суждений, основанных на моральных ценностях.

4.4 Мы заявляем о своей готовности поддерживать и претворять в жизнь программы научных исследований в области социальных наук и воспитания в духе терпимости, прав человека и ненасилия. Это означает необходимость уделения особого внимания вопросам повышения уровня педагогической подготовки, учебных планов, содержания учебников и занятий, совершенствования других учебных материалов, включая новые образовательные технологии, с целью воспитания чутких и ответственных граждан, открытых восприятию других культур, способных ценить свободу, уважать человеческое достоинство и индивидуальность, предупреждать конфликты или разрешать их ненасильственными средствами.

Статья 5 — Готовность к действию

 Мы обязуемся поощрять терпимость и ненасилие, используя для этого программы и учреждения в областях образования, науки, культуры и коммуникации.

Статья 6 — Международный день, посвященный терпимости

 В целях мобилизации общественности, привлечения внимания к опасностям, кроющимся в нетерпимости, и укрепления приверженности и активизации действий в поддержку поощрения терпимости и воспитания в ее духе мы торжественно провозглашаем 16 ноября ежегодно отмечаемым Международным днем, посвященным терпимости.

Ходорковский опроверг слова Путина о признании вины | Новости из Германии о России | DW

Михаил Ходорковский опроверг заявление президента России Владимира Путина о косвенном признании вины перед помилованием в 2013 году. Об этом он рассказал «МБХ медиа» в четверг, 10 декабря. «Ни прямого, ни косвенного признания вины не было. Владимир Путин или действительно не помнит, что я отказался от помилования с признанием вины, или умышленно вводит в заблуждение. Я благодарен ему, что он дал мне возможность попрощаться с мамой, и не в претензии, если это возрастная забывчивость», — заявил Ходорковский.

Ранее в тот же день Путин во время общения с членами Совета по правам человека утверждал, что Ходорковский «косвенно признал вину» перед помилованием. «Он косвенно признал, косвенно все равно. В письме ко мне признал и попросил его отпустить раньше срока, потому что у него мама болела. И я пошел на это и помиловал его для того, чтобы он мог общаться с мамой», — заявил Путин, комментируя слова о том, что в законе об амнистии нет пункта об обязательном признании осужденным его вины.

Дело ЮКОСа

Совладельца и главу нефтяной компании «ЮКОС» Михаила Ходорковского арестовали в 2003 году. В мае 2005 года его приговорили к девяти годам колонии, признав виновным в мошенничестве, хищении денег и сырья, а также в уклонении от уплаты налогов.  В 2010 году суд вынес приговор по второму делу ЮКОСа. Бизнесмен по совокупности получил 14 лет колонии. Его признали виновными в растрате нефти и отмывании незаконно полученной прибыли.

В декабре 2013 года Ходорковский  написал президенту прошение о помиловании. Тогда Путин упоминал, что тот ссылается на «обстоятельства гуманитарного характера»: «У него больна мать, и я считаю, что можно принять решение, и в ближайшее время будет подписан указ о его помиловании». Сразу после освобождения экс-глава ЮКОСа уехал из России.

ЕСПЧ признал нарушение права на справедливый суд в обоих делах Ходорковского, но не счел их политически мотивированными.

Смотрите также:

  • Михаил Ходорковский: 5 лет с момента ареста

    Супруга бывшего главы «ЮКОСа» Инна 15 декабря 2004 года во время акции «Свободу Михаилу Ходорковскому».

  • Михаил Ходорковский: 5 лет с момента ареста

    Процесс по делу Ходорковского и дело «ЮКОСа» вызвали острую критику из-за границы. Все попытки повлиять на Кремль, предпринимавшиеся на высоком политическом уровне, к успеху не привели. Правозащитные организации считают Ходорковского политическим заключенным, а вынесенный ему приговор — результатом судебного произвола. На фото: адвокат Ходорковского Роберт Амстердам во Франкфурте-на-Майне в январе 2007 года.

  • Михаил Ходорковский: 5 лет с момента ареста

    В декабре 2006 года Михаилу Ходорковскому и его бывшему деловому партнеру Платону Лебедеву были предъявлены новые обвинения по делу об отмывании денежных средств.

  • Михаил Ходорковский: 5 лет с момента ареста

    25 октября 2003 года Михаила Ходорковского взяли под стражу в аэропорту Новосибирска, а затем доставили в тюрьму «Матросская тишина» в Москве. Уже через несколько дней по распоряжению генеральной прокуратуры России были арестованы акции нефтяной компании «ЮКОС». Ходорковского объявили подозреваемым в уклонении от уплаты налогов и в других экономических преступлениях.

  • Михаил Ходорковский: 5 лет с момента ареста

    Сибирский город Краснокаменск, в котором расположена тюрьма, от Москвы отделяет шесть часовых поясов.

  • Михаил Ходорковский: 5 лет с момента ареста

    31 мая 2005 года Мещанский суд города Москвы признал Михаила Ходорковского виновным и приговорил к 9 годам лишения свободы, но позже сократил срок до 8 лет.

  • Михаил Ходорковский: 5 лет с момента ареста

    В этой колонии в Читинской области Михаил Ходорковский отбывает тюремное заключение.

  • Михаил Ходорковский: 5 лет с момента ареста

    22 сентября 2005 в «деле Ходорковского» была поставлена формальная точка. Московский городской суд утвердил обвинительный приговор.

  • Михаил Ходорковский: 5 лет с момента ареста

    Следствие по делу Ходорковского было закончено в рекордные сроки — за два месяца. Обвинения совпали с теми, которые ранее были предъявлены его партнеру по бизнесу Платону Лебедеву.

  • Михаил Ходорковский: 5 лет с момента ареста

    Уже в декабре 2004 года российские власти устроили аукцион по продаже акций одного из подразделений концерна — добывающей компании «Юганскнефтегаз». Выручка была направлена на уплату налоговой задолженности. Был сделан первый шаг в деле ликвидации «ЮКОСа».

  • Михаил Ходорковский: 5 лет с момента ареста

    К началу 2004 года глава нефтяной компании «ЮКОС» Михаил Ходорковский считался самым богатым человеком России и входил в список богатейших людей мира. Помимо предпринимательской деятельности он активно занимался социальными проектами, в частности в области образования, а также принимал участие в политической жизни, финансируя оппозиционные политические партии, что вызывало явное недовольство со стороны Кремля.

  • Михаил Ходорковский: 5 лет с момента ареста

    Одновременно увеличивался список обвиняемых прокуратурой сотрудников компании «ЮКОС». Весной 2005 года он насчитывал уже три десятка человек.


Что такое признание сотрудников? — Бонус

Как выглядит узнавание?

По сути, признание сотрудников — это открытое признание и выраженная признательность за вклад сотрудников в их организацию. 🎉

Это может быть высокая пятерка за хорошо выполненную работу, особый привет во время всеобщего собрания или даже бонус за достижение ежемесячной цели.

Признание может принимать разные формы, но независимо от вашего подхода, это одна из самых ценных областей, на которой может сосредоточиться команда. Внедрение правильной программы признания является решающим фактором в обеспечении конкурентоспособности вашего бизнеса. Имея это в виду, организации все чаще принимают и переосмысливают программы признания. Они сильны, и при правильном использовании могут повысить вовлеченность сотрудников, снизить текучесть кадров, повысить производительность, повысить моральный дух и достичь цели.

Кто дает признание?

В идеале каждый в организации должен уметь признавать друг друга.Тем не менее, наиболее эффективный источник признания зависит от ситуации и обстоятельств.

Распознавание сверху вниз

Признание традиционно дается по нисходящей системе, когда руководитель, менеджер или руководство сотрудника наблюдает за их вкладом и ценит его.

Это отличная модель по многим причинам: поскольку эти лидеры обычно принимают решения, их признание часто имеет денежные результаты, такие как повышение или продвижение по службе.Эти люди также могут лучше всего помочь сотрудникам с выбранным ими карьерным путем или планами роста.

Однако частое и конкретное признание в реальном времени — непростая задача для руководства. От менеджеров требуется, чтобы они засвидетельствовали, каталогизировали, распознали и вознаградили бесчисленные вклады.

В большинстве случаев слишком много ценных вкладов вносится ежедневно, чтобы подход, основанный исключительно на нисходящем признании, был эффективным. У большинства лидеров просто нет пропускной способности, чтобы отслеживать усердную работу каждого.Вот почему наиболее распространенной формой признания сверху вниз является ежегодный обзор сотрудника.

К сожалению, ежегодные обзоры могут стать серьезным источником стресса и, как правило, лишь подчеркивают самый большой и заметный вклад сотрудника. Ежегодные обзоры также включают предложения по улучшениям сотрудников, которые могут отвлекать от похвалы.

Нельзя сказать, что менеджеры вообще не должны признавать. Напротив, они обязательно должны! Когда дело доходит до достижения общих целей, признание высокопоставленных руководителей может подчеркнуть значимость достижений сотрудников. Однако в повседневной жизни неплохо попросить помощи у остальной команды.

Признание коллег

В системе взаимного признания менеджеры, а также другие сотрудники имеют право признавать и вознаграждать вклад всех остальных. Менеджерам легко поздравить сотрудника с его общей производительностью труда, но их коллеги работают рядом с ними день за днем. Им гораздо легче распознать конкретный вклад сотрудника и понять, какое влияние он оказывает.

Все просто. Вы видите, как товарищ по команде делает что-то ценное, а затем хвалите его за это.

Мы также не можем игнорировать преимущества распознавания снизу вверх. Менеджеры тоже нуждаются в оценке! Признание мотивирует и проницательно для всех, даже для тех, кто занимает руководящие должности. Благодаря распознаванию стиля на 360 градусов каждый в компании имеет право голоса в том, как он хочет выразить свою обратную связь. Признание непосредственных руководителей и руководителей за работу, которую они делают, — это не пустяк — это метод межличностного общения, который приносит пользу всем участникам.

Будет ли признание работать для моей команды?

Да! 😁

Каждая команда может воспользоваться программой признания.

Реализуя одну из них, вы даете сотрудникам возможность отметить достижения друг друга. Такое взаимодействие способствует созданию более сильных команд, развитию более богатой корпоративной культуры и мотивации сотрудников выполнять свою работу наилучшим образом. При успешном выполнении признание обеспечивает положительное влияние коллег и передает представление о том, что хорошая работа ценится всеми в компании.

Подводя итоги, можно сказать, что компании, получившие самые высокие баллы за построение «культуры признания», имеют на 31% меньшую текучесть кадров, чем их коллеги. Более того, сотрудники, которые не чувствуют себя признанными, в два раза чаще увольняются в течение года.

В конце концов, быть оцененным просто приятно. Почему? Он высвобождает поток окситоцина, химического вещества, которое создается нашим телом, когда мы связываемся с другими и чувствуем себя любимыми. Отчет TINYpulse о вовлеченности сотрудников и организационной культуре показал, что 58% самых счастливых сотрудников признают и поощряют успех своих коллег, если им предоставят инструменты, облегчающие эту задачу.

Культура, основанная на признании, — достойная и достижимая цель для любой организации в любой отрасли. Это приносит пользу всей команде, от новичка до генерального директора.

Ключ к успеху — это понимание того, как работает признание сотрудников, и как эффективно реализовать его в вашей уникальной среде.

Сколько это будет стоить?

Большинство организаций без официальной программы признания уже тратят деньги на признание. От организации праздничных обедов до оптовых закупок подарочных карт труд и затраты, связанные с «ручным» распознаванием, могут быстро возрасти.Этот метод признания имеет тенденцию быть спорадическим и может потребовать много времени для управления руководителями или сотрудниками отдела кадров.

Бюджет обычно учитывается — просто распределяется менее эффективно под другим названием. Также подумайте, кому еще выгодно признание. Скорее всего, лица, принимающие решения в других отделах, также видят необходимость признания и будут готовы присоединиться к ним.

Эффективная программа обычно окупается и больше в виде повышения мотивации, производительности, вовлеченности и удержания.В следующем разделе вы узнаете, как признание положительно влияет на каждый из этих факторов.

Но почему?

Понимание признания сотрудников — это первый шаг, и в следующей главе мы расскажем, почему признание сотрудников важно. Прочтите больше, чтобы узнать о многих преимуществах признания сотрудников и о том, как использование программы признания, такой как Bonusly, может быть чрезвычайно эффективным способом для команд чувствовать себя ценными, работать лучше, оставаться вовлеченным и многое другое.Мы приглашаем вас совершить поездку по платформе и присоединиться к нам для демонстрации, чтобы узнать больше о том, как вы можете начать создавать богатую признанием организационную культуру.

Хотите получить это руководство бесплатно в формате PDF? Мы отправим вам копию по электронной почте.

Пришлите мне гида!

Программы признания / Программы вознаграждения и признания

Эффективная программа признания сотрудников может повлиять на прибыль

Исследование, проведенное Forbes, показало, что компании, попавшие в 20% лучших за построение «культуры признания», на самом деле имели на 31% меньшую текучесть кадров.Это говорит о том, что признание имеет значение и должно быть важной частью повестки дня вашего отдела кадров.

Программа признания сотрудников предназначена для признания сотрудников за их упорный труд и успехи на работе. Многие организации реализуют программы признания и поощрения, чтобы поощрять сотрудников, повышать производительность и поднимать моральный дух.

Разработка программы признания

При разработке программы признания лучше всего собирать отзывы сотрудников и высшего руководства о том, что, по их мнению, следует признать и как они хотели бы получить признание. Получение отзывов поможет вам создать программу признания, в которой сотрудники будут более охотно участвовать.

Во-первых, взгляните на миссию и цели организации, чтобы найти цель для программы признания. Собирая идеи воедино, подумайте также о критериях признания. Кроме того, есть ли у вас бюджет для вашей программы? Как вы будете продвигать программу среди сотрудников?

Затем определите программу. Теперь, когда вы продумали свои идеи, создайте процесс для своей программы распознавания.Обязательно учитывайте частоту признания, награды, право на участие, процесс номинации и т. Д.

Имейте в виду, что на протяжении всего процесса создания вашей программы признания вы должны сообщать сотрудникам, что она приближается, и разъяснять программу лично с сотрудниками, чтобы убедиться, что все полностью понимают, как программа будет работать, чтобы все участвовали .

Лучшие практики для вашей программы признания

Существует множество передовых методов, которые можно использовать при реализации программы вознаграждения и признания сотрудников. Вот 3 наших лучших практических метода:

Говорите. Людям нравится, когда их ценят, поэтому проявите свою признательность и по-настоящему узнайте этого сотрудника. Будь то объявление об этом на еженедельной встрече, выделение этого в корпоративном информационном бюллетене по электронной почте или другие способы показать свое признание, важно, чтобы этот человек почувствовал, что его работа ценится. В свою очередь, другие заметят, и это повысит ожидания команды.

Будьте конкретны. Не просто присуждайте стандартную награду «Сотрудник месяца», а вместо этого признавайте и награждайте сотрудников на конкретных примерах того, что они делают все возможное в своей работе. Это дает всем сотрудникам представление о том, что ценится в офисе.

Будьте достижимы. Убедитесь, что достижения, которых вы ищете, не связаны с обременительными обязанностями сотрудников. Это приводит к стрессу и отсутствию мотивации. Щедро выражайте признание. Это означает, что чаще награждайте сотрудников за их усердный труд! Кроме того, не вознаграждайте только за крупные достижения, а вместо этого поблагодарите Мишель за то, что она задержалась в понедельник, чтобы завершить проект, или Билла за подготовку презентации в последнюю минуту.Это гарантирует, что ваши сотрудники будут чувствовать себя оцененными и воодушевленными, а также даст им понять, что вы уделяете внимание их тяжелой работе.

Узнайте больше о программах признания, присоединившись к сети Recognition Professionals International. Recognition Professionals International — единственная профессиональная ассоциация, стоящая на переднем крае признания сотрудников. Они предоставляют информацию и ресурсы для профессионалов, которые помогут разработать лучшие ведущие программы признания в любой отрасли и для любой организации.

Присоединяйтесь к нашей мощной и увлеченной сети профессионалов в области признания сегодня.

Признание сотрудников: низкая стоимость, высокая эффективность

Основные моменты истории
  • Лучшие исполнители должны знать, что их усилия признаны и оценены
  • Признание сотрудников не является универсальным
  • Деньги — не единственная и даже не главная форма признания

В сегодняшней войне за таланты организации и лидеры ищут стратегии для привлечения и удержания своих лучших сотрудников при одновременном повышении органического роста и производительности сотрудников. От предложения новых преимуществ до разработки гибких рабочих мест — усилия компании по оптимизации рабочего места как никогда сильны.

Но в поисках новых идей и подходов организации могут упускать из виду одну из наиболее легко реализуемых стратегий: признание сотрудников.

Согласно анализу Gallup, только каждый третий работник в США полностью согласен с тем, что они получили признание или похвалу за хорошую работу за последние семь дней. В любой компании сотрудники нередко чувствуют, что все их усилия постоянно игнорируются.Кроме того, сотрудники, которые не чувствуют себя должным образом признанными, в два раза чаще заявляют, что увольняются в следующем году.

Этот элемент вовлеченности и производительности может быть одной из величайших упущенных возможностей для руководителей и менеджеров.

Признание на рабочем месте мотивирует, дает чувство выполненного долга и заставляет сотрудников чувствовать, что их работа ценится. Признание не только повышает вовлеченность отдельных сотрудников, но также повышает продуктивность и лояльность к компании, что приводит к более высокому удержанию.

Помимо выражения признательности и мотивации признанного сотрудника, акт признания также отправляет другим сотрудникам сообщения о том, как выглядит успех. Таким образом, признание является одновременно инструментом личного вознаграждения и возможностью укрепить желаемую культуру организации для других сотрудников.

Подтверждение личности Данные

Gallup показывают, что наиболее эффективное признание — это честное, подлинное и , индивидуализированное в зависимости от того, как каждый сотрудник хочет, чтобы его узнали.Признание лучшей работы сотрудников может быть недорогостоящим мероприятием — всего лишь личной запиской или открыткой с благодарностью. Но ключ в том, чтобы знать , что делает значимым и запоминающимся для сотрудника, а — кто распознает.

В недавнем опросе Gallup на рабочем месте сотрудников попросили вспомнить, кто дал им самое значимое и запоминающееся признание. Данные показали, что наиболее запоминающееся признание чаще всего исходит от руководителя сотрудника (28%), за которым следуют руководитель или генеральный директор высокого уровня (24%), менеджер менеджера (12%), клиент (10%) и коллеги ( 9%). Стоит отметить, что 17% назвали «другое» источником своего самого запоминающегося признания.

Что самое удивительное в этих выводах? Почти четверть респондентов отметили, что наиболее запоминающимся признанием является руководитель или генеральный директор высокого уровня. Сотрудники будут помнить личные отзывы генерального директора — даже небольшое количество времени, которое высокопоставленный руководитель тратит на то, чтобы выразить признательность, может произвести на сотрудника положительное впечатление. Фактически, признание со стороны генерального директора может стать ярким событием в карьере.

На вопрос о том, какие типы признания запомнились больше всего, респонденты выделили, в частности, шесть методов — и деньги — не единственная (или главная) форма признания:

  • общественное признание или признание посредством награды, сертификата или благодарности
  • личное признание начальника, коллеги или клиента
  • получение или получение высокого уровня достижений посредством оценок или обзоров
  • продвижение по службе или увеличение объема работы или ответственности, чтобы показать доверие
  • денежное вознаграждение, такое как поездка, приз или повышение заработной платы
  • личное удовлетворение или гордость за работу

Признание со всех сторон

Лучшие менеджеры способствуют созданию атмосферы признания, в которой хвалят со всех сторон, и каждый знает, как другие любят получать признание. Этот тип обратной связи с сотрудниками должен быть частым — Gallup рекомендует каждые семь дней — и своевременным, чтобы гарантировать, что сотрудник знает значимость недавнего достижения, и укрепить ценности компании.

Критерии признания должны соответствовать цели, бренду и культуре компании и отражать ее стремление к индивидуальности, чтобы вдохновлять других. Поощрение сотрудников, не являющихся лучшими исполнителями, может отрицательно сказаться на мотивации высокоэффективных сотрудников. Таким образом, компании должны указать конкретные стандарты для наград, чтобы избежать негативной реакции.

Великие менеджеры знают, что никогда не смогут дать слишком много признания, если оно будет честным и заслуженным. Признание лучшей работы сотрудника имеет большое значение для того, чтобы заставить его или ее почувствовать себя ценным и может привести к другим желательным результатам на рабочем месте.

Узнайте больше об использовании CliftonStrengths, чтобы помочь себе и другим добиться успеха:

Новое исследование открывает секрет признания сотрудников

Мы только что завершили комплексный исследовательский проект по признанию сотрудников (говоря «спасибо»), и результаты действительно поразительны: организации, которые регулярно благодарят своих сотрудников, намного превосходят те, которые этого не делают.

Сегодня рынок признания сотрудников (золотые часы, значки, благодарственные награды, плакаты и т. Д.) Оценивается в 46 миллиардов долларов, и наши исследования показывают, что компании тратят 1-2% от фонда заработной платы на такие вещи. Это огромный рынок.

Тем не менее, когда мы посмотрели, куда идут эти деньги, мы обнаружили, что 87% программ признания сосредоточены на владении и владении. Да это правильно. Люди получают вознаграждение за , придерживаясь .

Наше исследование показало, что системы вознаграждения, основанные на сроках пребывания в должности, практически не влияют на деятельность организации .Вы проработали дополнительный год на последней работе, чтобы получить значок на 10 лет? Я в этом сомневаюсь.

Оказывается, что многие из этих программ поощрения за выслугу лет на самом деле являются программами, унаследованными от начала века, когда профсоюзы вынуждали руководство назначать сотрудникам «служебные награды» и почасовые повышения за время пребывания в должности. В большинстве крупных компаний эти программы существуют и сегодня, но только 58% сотрудников знают о существовании таких программ. Так что по большей части они не создают большой ценности.

С другой стороны, наше исследование показало, что современные переработанные программы распознавания могут иметь огромное влияние на эффективность бизнеса.Компании, которые попали в топ-20% за создание «культуры признания», на самом деле имели на 31% меньшую текучесть кадров! Это огромная статистика. Большинство генеральных директоров заплатили бы миллионы долларов за сокращение добровольной текучести (это когда хорошие люди уходят сами). Оказывается, такого результата можно добиться с помощью грамотно разработанной программы распознавания.

Позвольте мне перечислить 5 лучших лучших практик, которые мы обнаружили:

1. Узнавайте людей по определенным результатам и поведению.

Не давайте просто вознаграждение за то, что он «работник месяца». Дайте им награду за выдающееся обслуживание клиентов при возникновении конкретной проблемы. Это создает культуру «поступать правильно».

2. Реализуйте одноранговое распознавание, а не сверху вниз.

Признание лидеров оказывает меньшее влияние, чем вы думаете. Хотя менеджеры по персоналу считают, что это ключевой критерий успеха, сотрудники сказали нам, что они чувствуют себя намного лучше, когда их признают коллеги.Почему это? Коллеги знают, что вы делаете изо дня в день, поэтому, когда они «благодарят вас» за ваши усилия, влияние оказывается гораздо более значимым. Признание сверху вниз часто рассматривается как политическое, и оно редко достигает «тихих, но критичных высокопроизводительных сотрудников» в компании.

Современные высокопроизводительные программы признания являются «социальными» — они позволяют любому сотруднику компании узнавать кого-либо еще (часто используя «баллы» или «доллары»). Благодарности полностью публичны и отображаются в «таблице лидеров», чтобы любой мог увидеть их. Горячие стартапы, такие как Achievers и Globoforce, продают облачные платформы, которые упрощают эту задачу, и традиционные компании, предлагающие вознаграждение, такие как OC Tanner, также движутся в этом направлении.

3. Поделитесь историями признания.

Одним из наиболее эффективных методов, которые мы определили, было «рассказывание историй». Когда кто-то делает что-то великое и его признают коллеги, расскажите об этом людям. Они не только должны получить парковочное место «Сотрудник месяца» (шучу — они напоминают мне, кстати, фильм «Офисное пространство»), но вы должны упомянуть их в информационном бюллетене или блоге компании.Эти истории способствуют вовлечению и обучению сотрудников.

В нашем бизнесе мы проводим еженедельные конференц-звонки в масштабах всей компании, и мы стараемся каждую неделю отмечать кого-то за их вклад. Это не только улучшает самочувствие человека, но и позволяет нашей руководящей команде продвигать поведение и результаты, которых мы ожидаем от всех. Мы также используем одноранговую систему, которая создает свою собственную «раскадровку» производительности и благодарности.

4. Сделайте распознавание простым и частым.

Сделайте так, чтобы сотрудникам было легко узнавать друг друга. Многие из современных программ, которые мы изучили, дают всем сотрудникам бюджет в «баллах» или «долларах», и они могут передать их другим онлайн за секунды. Мы используем одну из этих систем в нашей компании, и результаты были потрясающими. Люди, которые делают великие дела, теперь видны всем!

5. Свяжите признание с ценностями или целями вашей компании.

Такие компании, как Deloitte и Intuit, имеют программы признания, ориентированные на миссию и цели компании.Поэтому, когда вы вручаете кому-либо награду «спасибо», она привязана к стратегии вашей компании (обслуживание клиентов, инновации, командная работа или даже цель сокращения доходов или затрат).

Я знаю, что это звучит пушисто и не по-деловому, но поверьте мне, это работает. Слишком многие генеральные директора и менеджеры сосредотачиваются на конечных результатах, не задумываясь о том, каково это усердно работать, не сказав ни слова благодарности.

Психология узнавания

В иерархии потребностей Маслоу две самые ценные психологические потребности, которые есть у нас, как у людей, — это потребность в том, чтобы их ценили, и потребность «принадлежать».«Эти потребности удовлетворяются посредством взаимной благодарности и признания. Взгляните на иерархию ниже: вы можете увидеть, что компенсация и льготы поддерживают основную потребность, но признание и продвижение по службе поддерживают наши психологические потребности более высокого уровня.

Рис. 1. Иерархия потребностей Маслоу (и где уместно признание)

Помните, что цель признания — повысить уровень «дискреционных усилий». Такие дискреционные усилия возникают, когда мы, как люди, чувствуем побуждение делать больше.

Гормоны играют свою роль

Одно последнее очко. Признание оказывает физиологическое влияние на производительность.

Окситоцин — хорошо известный «гормон любви». Наши тела вырабатывают окситоцин, когда мы чувствуем себя любимыми или ценными (даже если кому-то пожать руку или обнять его, этот гормон образуется). Недавние исследования показывают, что люди, которые работают под воздействием окситоцина, работают лучше и заслуживают большего доверия.

Когда ваша компания внедряет современную программу признания, и люди начинают благодарить друг друга, возрастает доверие и вовлеченность, улучшая моральный дух сотрудников, повышая качество и качество обслуживания клиентов.

Конечно, признание не отменяет необходимости обратной связи, отчетности и постановки целей. Эти программы управления производительностью по-прежнему крайне необходимы для обеспечения согласованности и производительности. Но наше исследование определенно показывает, что 83% исследованных нами организаций страдают от дефицита «узнаваемости». И эти компании отстают от конкурентов.

И еще кое-что. Признание — это не только то, что должны делать руководители — оно должно происходить во всей организации.Исследование ясно показывает, что нисходящее признание — это не то, что делает компании сегодня успешными, а признание ваших коллег, людей, с которыми вы работаете каждый день.

В следующий раз, когда вы увидите, что кто-то поступает правильно, найдите минутку и открыто поблагодарите его.

Это хороший менеджмент и хороший бизнес.

(Для получения дополнительной информации прочтите обзор рынка «Превращение благодарности в производительность».)

Новый механизм распознавания ДНК с высоким содержанием AT для бактериального ксеногенного глушителя MvaT

Abstract

Бактериальные ксеногенные белки сайленсинга избирательно связываются и подавляют экспрессию из многих областей хромосомы, богатых AT.Они служат главными регуляторами горизонтально приобретаемой ДНК, включая большое количество генов вирулентности. К настоящему времени идентифицированы три различных семейства ксеногенных сайленсеров: H-NS Proteobacteria, Lsr2 актиномицетов и MvaT Pseudomonas sp. Хотя белки семейств H-NS и Lsr2 структурно различаются, все они распознают малую бороздку AT-богатой ДНК через общий AT-крючкообразный мотив, который отсутствует в семействе MvaT. Таким образом, механизм связывания ДНК MvaT не определен.Здесь мы сообщаем характеристики последовательностей ДНК, на которые нацелен MvaT, с помощью микрочипов связывания белков, что указывает на то, что MvaT предпочитает связывание гибких последовательностей ДНК с несколькими этапами TpA. Мы демонстрируем явные различия в предпочтениях последовательностей между MvaT и двумя другими семействами ксеногенных глушителей. Мы также определили структуру ДНК-связывающего домена MvaT в комплексе с высокоаффинным додекамером ДНК, используя ЯМР в растворе. Это первая экспериментальная структура ксеногенного сайленсера в комплексе с ДНК, которая показывает, что MvaT распознает АТ-богатую ДНК как посредством считывания оснований мотивом «AT-pincer», вставленного в малую бороздку, так и посредством считывания формы несколькими лизиновыми сторонами. цепи, взаимодействующие с сахарно-фосфатным остовом ДНК.Мутации ключевых остатков MvaT для связывания ДНК подтверждают их важность с помощью анализов in vitro и in vivo . Этот новый способ связывания ДНК позволяет MvaT лучше переносить прерывания пар оснований GC в сайте связывания и меньше отдавать предпочтение ДНК тракта А по сравнению с H-NS и Lsr2. Сравнение MvaT с другими бактериальными ксеногенными глушителями дает ясную картину того, что природа разработала уникальные решения для разных родов бактерий, чтобы отличать чужеродную ДНК от собственной.

Сведения об авторе

В процессе эволюции бактерии часто приобретают новые гены посредством горизонтального переноса, чтобы адаптироваться к новой среде. Однако приобретенные чужеродные последовательности ДНК скорее уменьшат, чем увеличат приспособленность бактерий-реципиентов. Поэтому многие роды бактерий развили уникальные белки, которые избирательно подавляют транскрипцию чужеродных генов. Условно-патогенный микроорганизм Pseudomonas aeruginosa является основной причиной заболеваемости и смертности пациентов с муковисцидозом и одной из основных причин нозокомиальных инфекций. В качестве ксеногенного сайленсера белок MvaT P . aeruginosa является главным регулятором горизонтально приобретенных генов, в том числе многих критических для устойчивости к лекарствам и вирулентности. Здесь мы охарактеризовали последовательности ДНК, на которые преимущественно нацелен MvaT, и выявили различия в предпочтениях последовательностей между MvaT и другими ксеногенными сайленсерами. Структура высокого разрешения ДНК-связывающего домена MvaT в комплексе с высокоаффинной ДНК-мишенью выявляет новый механизм распознавания малых бороздок ДНК, богатых AT, который прекрасно объясняет характерные особенности предпочтений последовательности ДНК MvaT.Сравнение MvaT и других бактериальных ксеногенных сайленсеров демонстрирует, как различные бактериальные роды использовали уникальные решения для отличия чужеродной ДНК от ДНК их собственного генома.

Образец цитирования: Ding P, McFarland KA, Jin S, Tong G, Duan B, Yang A, et al. (2015) Новый механизм распознавания ДНК с высоким содержанием AT для бактериального ксеногенного глушителя MvaT. PLoS Pathog 11 (6): e1004967. https://doi.org/10.1371/journal.ppat.1004967

Редактор: Чжао-Цин Луо, Университет Пердью, СОЕДИНЕННЫЕ ШТАТЫ

Поступила: 19 января 2015 г .; Принята к печати: 21 мая 2015 г .; Опубликован: 11 июня 2015 г.

Авторские права: © 2015 Ding et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

Доступность данных: Все соответствующие данные либо в документе и файлах с вспомогательной информацией или в публичном хранилище. Координаты структур доступны в Protein Data Bank (инвентарные номера 2MXE и 2MXF).Назначения химического сдвига доступны в банке данных биомолекулярного магнитного резонанса (номера доступа 25405, 25407).

Финансирование: BX поддерживается грантом Национальной программы фундаментальных исследований Китая 973 Program (2012CB3) (www.most.gov.cn). WWN поддерживается операционным грантом Канадского института медицинских исследований (MOP-86683) (http://www.cihr-irsc.gc.ca/). SLD получил поддержку гранта AI105013 Национальных институтов здравоохранения (www.nih.gov). JL был поддержан грантом Национального фонда естественных наук Китая (31128005) (www.nsfc.gov.cn). TRH поддерживается грантом Канадского института медицинских исследований (MOP-111007) (http://www.cihr-irsc.gc.ca/). GT поддерживается стипендией Александра Грэхема Белла для выпускников Канады от Совета по естественным наукам и инженерным исследованиям Канады (NSERC). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует.

Введение

Горизонтальный перенос генов, или латеральный перенос генов, относится к приобретению организмом чужеродных генов не от прямого предка. Это основная эволюционная сила бактерий и одноклеточных эукариот [1], и недавнее исследование даже предполагает, что горизонтальный перенос генов также может вносить вклад в эволюцию животных [2]. Хотя бактерии часто приобретают чужеродные гены для адаптации к окружающей среде, экспрессия чужеродных генов в новом хозяине с большей вероятностью снижает приспособленность бактерий [3].Бактериальные ксеногенные белки сайленсинга избирательно связываются и репрессируют транскрипцию из областей ДНК, которые значительно более богаты AT, чем весь геном, которые, вероятно, будут получены посредством горизонтального переноса генов [4–6]. Подавляя экспрессию многих AT-богатых генов, эти сайленсеры повышают вероятность того, что вновь приобретенные последовательности будут переноситься организмом-реципиентом. Недавнее исследование также показывает, что одной из основных функций ксеногенных сайленсеров является подавление токсической инициации внутригенной транскрипции горизонтально приобретенной AT-богатой ДНК [7]. Молчание чужеродной ДНК может усилить эволюцию бактерий, позволяя пулу потенциально полезных генов тайно существовать в популяции. Такие гены иногда находят применение, когда отдельная клетка в популяции развивает необходимую регуляторную схему для контроля экспрессии гена в соответствующих условиях окружающей среды и времени [8–13]. В результате своей активности ксеногенные глушители являются главными регуляторами горизонтально приобретенных последовательностей, в том числе многих критических для лекарственной устойчивости и вирулентности, в большом количестве важных бактериальных патогенов, включая Mycobacteria , Vibrio , Salmonella , Escherichia , Yersinia , Bordetella и Pseudomonas [14–28].

Ксеногенные белки сайленсинга можно разделить на три отдельные группы на основе сходства последовательностей: H-NS-подобные белки, которые обнаруживаются во многих родах альфа, бета и гамма-протеобактерий, белки Lsr2, обнаруженные у актинобактерий, и MvaT -подобные белки псевдомонад [5]. Все они имеют одинаковую структуру доменов с N-концевым доменом олигомеризации и C-концевым доменом связывания ДНК [29, 30]. Эти белки могут кооперативно связываться с большими участками ДНК, и недавние исследования показывают, что образование нуклеопротеиновых филаментов важно для их функции подавления гена [31–34].ДНК-связывающие домены Lsr2 из Mycobacterium tuberculosis и H-NS из Escherichia coli и Salmonella typhimurium были решены, и их взаимодействия с ДНК были смоделированы с использованием данных титрования из исследований ЯМР [16, 29, 35– 37]. Интересно, что Lsr2 и H-NS, несмотря на то, что они структурно различны, используют общий механизм для избирательного нацеливания на AT-богатую ДНК путем встраивания AT-крючковидного мотива «Q / RGR» в малую бороздку ДНК. Другой белок семейства H-NS, Ler, в котором мотив, напоминающий крючок AT, заменен последовательностью «VGR», только вставляет боковую цепь аргинина в малую бороздку ДНК и может облегчить опосредованное H-NS молчание оперонов вирулентности в энтеропатогенном Е . coli [38].

MvaT был первоначально идентифицирован как глобальный регулятор экспрессии гена вирулентности в Pseudomonas aeruginosa , а впоследствии было показано, что он является репрессором фимбриального кластера cupA , необходимого для образования биопленок [23, 39, 40]. MvaT был охарактеризован как функциональный аналог H-NS из-за его способности дополнять различные фенотипы E . coli Δhns мутант [41]. Анализ транскриптома и иммунопреципитации хроматина в сочетании с ДНК-микрочипами (ChIP-on-chip) показал, что MvaT и его паралог MvaU предпочтительно связывают AT-богатые области P . aeruginosa , чтобы регулировать ~ 350 генов и что существует почти полное перекрытие в наборах генов, находящихся под контролем каждого белка, хотя почему существуют очевидно повторяющиеся паралоги, неясно [22, 42]. Помимо оперона cupA , много генов вирулентности от P . aeruginosa репрессируются MvaT / MvaU, например, гены, необходимые для синтеза окислительно-восстановительного пигмента и токсина пиоцианина, а также гены, относящиеся к системам секреции типа III и типа VI [22]. Потеря как MvaT, так и MvaU смертельна для P . aeruginosa штамм PAO1, феномен, который связывают с тем фактом, что эти белки ингибируют активацию профага Pf4 [43]. Структурные предсказания предполагают, что MvaT / MvaU, вероятно, произошел от семейства H-NS, однако оба белка имеют очень низкую идентичность последовательностей с H-NS и не имеют канонического мотива H-NS, который содержит структуру, подобную AT-крючку [5, 41] . Это оставляет открытым вопрос о том, как MvaT-подобные белки нацелены на ДНК, богатую AT.

В этой работе мы провели структурный и функциональный анализ ДНК-связывающих свойств MvaT. Высокопроизводительные анализы связывания ДНК показывают, что MvaT предпочитает очень гибкие последовательности, которые содержат несколько этапов TpA, и имеет значительную устойчивость к прерываниям пар оснований GC в сайтах связывания. Мы решили структуру раствора ДНК-связывающего домена MvaT в его свободной форме и в комплексе с высокоаффинным додекамером ДНК и обнаружили, что, как H-NS и Lsr2, MvaT распознает структурные особенности в малой бороздке, уникальные для AT-богатых ДНК. С мотивом «AT-pincer», вставленным в малую бороздку, и несколькими остатками лизина, взаимодействующими с сахарно-фосфатным остовом ДНК, двойная спираль была искажена значительным открытием малой бороздки, напоминающей несколько других белков, нацеленных на гибкие последовательности, богатые TpA. . Роль остатков, считающихся критическими для связывания, была оценена как in vitro, и in vivo, , которые показали, что, хотя одиночные замены аминокислот не полностью отменяют активность связывания ДНК из-за обширных контактов между MvaT и ДНК, эти замены с значительно сниженная активность связывания ДНК делает белок нефункциональным in vivo .Наконец, наши структурные данные показывают, что MvaT-подобные белки, вероятно, произошли от паралога H-NS, но приобрели способ связывания, который значительно отличается от других ксеногенных сайленсеров.

Результаты

MvaT связывается со своей целевой ДНК с медленной скоростью

Предыдущий анализ ChIP-on-chip показал, что MvaT преимущественно связывается с AT-богатыми участками хромосомы [22]. Анализы сдвига электрофоретической подвижности (EMSA) проводили с очищенным полноразмерным MvaT против меченного радиоактивным изотопом фрагмента промотора cupA1 размером 340 п.н. (% GC = 54), который, как ранее было показано, связывает MvaT in vivo, и in vitro, .В качестве отрицательного контроля мы использовали фрагмент 204 п.н. P . aeruginosa Ген PAO1 PA3900 (% GC = 74), который находится в пределах GC-богатой области генома размером ~ 180 т.п.н., не содержащей никаких сайтов связывания MvaT in vivo . MvaT был способен сдвигать оба меченых фрагмента ДНК при инкубации с любым фрагментом отдельно, с очевидными константами диссоциации 57 ± 22 нМ и 154 ± 53 нМ в сторону промотора cupA1 и PA3900 фрагментов, соответственно.Аффинность связывания MvaT с GC-богатым фрагментом PA3900 очень близка к таковой (~ 148 нМ), определенной ранее с помощью EMSA [32].

Хотя сродство MvaT к ДНК промотора cupA1 всего в ~ 3 раза выше, чем у фрагмента PA3900 , при использовании конкурентных анализов наблюдались значительные различия (рис. 1). MvaT, предварительно инкубированный с радиоактивно меченным GC-богатым фрагментом PA3900 , был замещен немеченой промоторной ДНК cupA1 при менее чем 5-кратном молярном избытке.Напротив, 200-кратный избыток немеченой ДНК PA3900 не смог вытеснить MvaT из предварительно сформированного комплекса с радиоактивно меченным фрагментом cupA1 . Эти данные указывают на то, что олигомеры MvaT, вероятно, взаимодействуют с GC-богатой ДНК посредством серии сопряженных низкоаффинных взаимодействий. Субъединицы в олигомерах MvaT часто диссоциируют от GC-богатой мишени, что позволяет быстро удалить белковый олигомер из ДНК. На фрагменте промотора cupA1 , который является сравнительно AT-богатым, белок MvaT образует олигомерный комплекс, достаточно стабильный, и для его замещения требуется 25-кратный избыток немеченой ДНК cupA1 .Это указывает на то, что после связывания с соответствующим целевым фрагментом олигомеры MvaT образуют высокостабильные комплексы, которые диссоциируют с очень медленными скоростями. Эти результаты согласуются с открытием, что MvaT может кооперативно связываться с большими участками ДНК и формировать нуклеопротеиновые филаменты [32]. В таких нуклеопротеиновых филаментах диссоциация MvaT в основном происходит на двух концах, где затраты энергии ниже, чем внутри филамента, что приводит к замедлению скорости связывания.

Рис 1.Анализ конкурентного связывания ДНК для связывания MvaT с ДНК промотора cupA1 и фрагментом PA3900 .

Комплексы MvaT (300 нМ) с 1 нМ радиоактивно меченным фрагментом ДНК промотора АТ cupA1 (верхняя панель) или радиоактивно меченным GC-богатым фрагментом ДНК PA3900 (нижняя панель) были предварительно сформированы перед добавлением избытка немеченой ДНК конкурента, как указано.

https://doi.org/10.1371/journal.ppat.1004967.g001

MvaT демонстрирует тонкие, но явные отличия в предпочтениях последовательностей ДНК от H-NS и Lsr2

Специфичность связывания ДНК MvaT дополнительно исследовали с использованием микрочипов связывания белков (PBM). Меченый GST MvaT применяли к микрочипам, содержащим 41944 двухцепочечных 60-мерных олигонуклеотидных целевых последовательностей, каждая из которых содержит константную 25-членную последовательность праймера, за которой следует вариабельная 35-членная последовательность. Два разных массива (обозначенных ME и HK) были разработаны таким образом, что все возможные непалиндромные 8-мерные представлены 32 раза (16 раз для палиндромных 8-мерных) на каждом массиве [44, 45]. Объединенные данные (среднее значение) из двух независимых экспериментов с массивами были использованы для анализа относительных предпочтений связывания, обеспечивая беспристрастную оценку относительного предпочтения каждого 8-мера, которая устойчива к вариациям положения, местоположения и фланкирующей последовательности [29, 44] .

Относительное предпочтение связывания MvaT для каждой 8-мерной последовательности рассчитывали с использованием основанной на рангах непараметрической статистической меры ( E -балл), которая в значительной степени инвариантна к концентрациям белка. Это облегчает сравнение разных экспериментов в одном масштабе, что полезно при оценке различий в мишенях связывания между разными белками, такими как MvaT и H-NS [44, 46]. Оценка E варьируется от 0,5 (самый высокий) до -0,5 (самый низкий). Случайные перестановки данных массива указывают на то, что не должно быть случайной 8-мерной последовательности, которая достигает значения E выше 0.45 [47]. Эксперименты с PBM идентифицировали множественные 8-меры с оценкой E выше 0,45 для MvaT, а наивысшая оценка была около 0,49, что указывает на то, что некоторые последовательности были явно предпочтительными мишенями для связывания MvaT, чем другие (S1 Dataset).

Как показано на рис. 2, целевые предпочтения MvaT сравнивались с теми, которые ранее были определены в аналогичных экспериментах для H-NS и Lsr2 [29]. В соответствии с более ранними исследованиями последовательности, наиболее тесно связанные со всеми тремя белками, были в подавляющем большинстве случаев AT-богатыми, поскольку оценка PBM E MvaT также положительно коррелирует с содержанием AT в 8-мерах (рис. 2A).Это обеспечивает основу для их функционального сходства и того, что MvaT может дополнять различные фенотипы E . coli Δhns мутант [41].

Рис. 2. Микроматричный анализ связывания белков предпочтений связывания ДНК для MvaT, H-NS и Lsr2.

Данные

PBM для H-NS и Lsr2 были опубликованы ранее [29]. Коробчатые диаграммы Тьюки показывают распределение баллов E 8-мерных олигонуклеотидных последовательностей, а усы указывают точки в пределах 1,5 межквартильного диапазона.На всех диаграммах параметры последовательности нанесены на график по шкале E , которая отражает относительное сродство к конкретной последовательности. (A) E -оценка по сравнению с содержанием AT 8-мерной целевой последовательности. (B) Количество стадий TpA для олигонуклеотидов, содержащих только A или T (100% AT). (C) Длина последовательности (последовательностей) A-тракта в 8-мерах с% GC ≥ 75. Некоторые последовательности содержат два A-тракта (например, AAAGGAAA), и в этих случаях указывается длина каждого. (D) E -оценка по сравнению с максимальной длиной непрерывных оснований A или T в последовательности 75% AT.Последовательности, такие как GCAATAAT, имеют 6 соседних оснований A или T, в то время как самый длинный участок соседних оснований A или T в 8-мерном AAGTTCAA составляет 2.

https://doi.org/10.1371/journal.ppat.1004967.g002

Однако более подробное сравнение предпочтений связывания между MvaT, H-NS и Lsr2 показывает, что существуют тонкие, но важные различия в способах связывания. И H-NS, и MvaT смещены в сторону последовательностей, содержащих несколько динуклеотидных стадий TpA (также называемых стадиями TpA), тогда как стадии TpA не влияют на связывание Lsr2 (рис. 2B).Действительно, последовательности с наивысшим сродством как к H-NS, так и к MvaT были составлены из нескольких смежных ступеней TpA, и одним из 8-меров с наивысшим баллом для каждой был TATATATA. Однако отсутствие шагов TpA в данной последовательности приводит к более высокому штрафу за связывание MvaT, чем за H-NS или Lsr2.

Больше, чем любая другая динуклеотидная стадия, включая стадии, содержащие G или C, TpA придает ДНК наибольшую гибкость [48]. Напротив, A-тракты (последовательности, состоящие из нескольких последовательных оснований A или T без TpA-шага) являются наиболее жесткими и негибкими из всех последовательностей ДНК [49].Наложение базового слоя в последовательностях А-тракта также сжимает малую бороздку больше, чем любой другой тип последовательности. В то время как присутствие A-трактов в последовательности в целом улучшало связывание как H-NS, так и Lsr2, A-тракты накладывали значительный штраф на связывание MvaT (фиг. 2C).

Также оценивалось влияние оснований G или C в целевом сайте на связывание с различными белками (рис. 2D). Примечательно, что все белки имели более низкое сродство к последовательностям, богатым АТ, когда один нуклеотид G или C был помещен в центр, но влияние на связывание MvaT было наименьшим.Оценивали связывание белков с 8-мерными последовательностями, содержащими шесть оснований A или T и два основания G или C в различных положениях. 8-мерные последовательности с двумя основаниями G или C могут иметь от 6 соседних нуклеотидов A или T (например, AATATAGG) до всего двух (например, AAGTTGAA). Эти данные показывают, что штраф как для H-NS, так и для Lsr2 увеличивается по мере уменьшения числа смежных нуклеотидов A или T. MvaT, с другой стороны, оказался более толерантным к прерыванию нуклеотидами G или C в пределах участка связывания, богатого AT, и многие 8-мерные последовательности с высокими показателями содержали только наборы из двух соседних нуклеотидов T или A.Эти различия в предпочтениях последовательностей подразумевают, что механизм распознавания ДНК MvaT может отличаться от механизма распознавания ДНК H-NS и Lsr2.

В последнее время были достигнуты значительные успехи в вычислительном прогнозировании конкретных параметров структуры ДНК. Структуры MvaT-связанных последовательностей, предсказанные с помощью DNAshape [50], показывают, что 20 лучших последовательностей с 100% AT 8-мерными оценками заметно отличаются по структуре от 20 100% AT 8-меров с самым низким показателем (S1 Рис. ). Последовательности с высоким уровнем связывания MvaT E — все содержат значительные участки, где малая бороздка превышает 5.5 Å в ширину, в то время как последовательности, получившие наименьшее количество баллов, по прогнозам, содержат гораздо более узкие малые бороздки, обычно менее 4 Å. Последовательности с наивысшей оценкой также имели более высокие значения для крена и кручения гребного винта и более низкие значения для винтовой кручения, чем последовательности с более низкой оценкой.

C-концевой домен MvaT связывает AT-богатую ДНК в малой бороздке

Мы определили структуру раствора С-концевого ДНК-связывающего домена MvaT (MvaT ctd , остатки 77–124) из P . aeruginosa штамм PAO1 с использованием ядерного магнитного резонанса (ЯМР) с почти полным резонансным назначением (S2 фиг.). Ограничения и структурная статистика приведены в Таблице 1. MvaT ctd состоит из трехцепочечного антипараллельного β-листа (β1, остатки 83–86; β2, остатки 93–96; β3, остатки 120–122) и двух α -спирали (α1, остатки 102–111; α2, остатки 113–119). MvaT ctd принимает топологию β1-β2-α1-α2-β3, а петля (loop2, остатки 97–101) связывает шпильку β1-β2 и спирали α1-α2.N- и C-концевые области очень гибкие (рис. 3A). Две последовательные спирали упакованы на одной стороне трехцепочечного β-листа и образуют гидрофобное ядро, состоящее из остатков Tyr85, Ile94, Thr96, Thr103, Leu104, Trp107, Trp111, Val116, Trp119 и Ala120 (рис. 3B). Общий состав складок и вторичной структуры MvaT ctd аналогичен таковым из C-концевого домена H-NS (H-NS ctd ), за исключением того, что H-NS ctd не имеет третьей цепи β3. и это спираль 3 10 вместо спирали α2 в MvaT ctd [29].

Рис. 3. Структура раствора MvaT ctd и его взаимодействие с AT-богатой ДНК.

(A) Наложение магистральных трасс для ансамбля из 20 структур MvaT ctd . (B) Ленточное представление средней структуры MvaT ctd . Боковые цепи остатков, образующих гидрофобное ядро, показаны оранжевым цветом. (C) Наложение 2D 1 H- 15 N HSQC-спектров свободного (синий) и ДНК-связанного MvaT ctd (красный, соотношение концентраций 1: 1).Указаны остатки, показывающие значительные изменения химического сдвига. (D) Комбинированные разности химического сдвига 1 H и 15 N (Δδ гребенка = [δ HN 2 + (δ N / 6,5) 2 ] 1/2 ) между свободный и связанный с ДНК-MavT ctd нанесены на график в зависимости от номера остатка (синие столбцы). (E) Наложение области отпечатка пальца, показывающее пики NOE h2’-H6 / H8 внутри остатка спектров 2D 1 H NOESY свободной (синий) и MvaT ctd -связанной ДНК (красный; соотношение концентраций 1: 1).Последовательность и вторичная структура додекамера ДНК показаны выше, а остатки, на которые влияет связывание MvaT ctd , показаны зеленым цветом. (F) 1 H разности химических сдвигов (Δδ) для h2 ’(синие столбцы) и H6 / H8 (желтые столбцы) между свободной ДНК и ДНК, связанной с MvaT ctd , нанесены на график в зависимости от количества остатков.

https://doi.org/10.1371/journal.ppat.1004967.g003

Поверхности взаимодействия MvaT ctd и ДНК картировали с помощью экспериментов по титрованию ЯМР.Дуплекс ДНК d (CGCATATATGCG) 2 , который мы называем «3AT», был выбран, поскольку он содержит последовательность среди тех, которые получили самые высокие баллы в нашем исследовании PBM. Сравнение 2D 1 H- 15 N HSQC-спектров MvaT ctd в свободной и ДНК-связанной форме показывает, что остатки со значительными комбинированными различиями химического сдвига NH (Δδ гребешок > 0,25 м.д.) представляют собой Arg80, Lys81 , Tyr85 и Lys97-Lys105 (фиг. 3C и 3D), в основном расположены в N-концевой области, loop2 и начале спирали α1.Эти остатки, за исключением Tyr85, сгруппированы в структуре MvaT ctd , составляя сайт связывания ДНК. На Tyr85, вероятно, воздействуют косвенно через его ароматическую боковую цепь, которая выходит прямо к петле 2. Стехиометрия связывания представляет собой одну молекулу MvaT ctd с одной молекулой дуплекса 3AT, что оценивается путем подбора изменений химического сдвига с различными концентрациями ДНК, что также было подтверждено результатами калориметрии изотермического титрования (ITC, см. Ниже).Сравнивая 2D 1 H NOESY спектры ДНК, свободной или в комплексе с белком, мы также картировали области 3AT, которые взаимодействуют с MvaT ctd . Значительные внутриостаточные сдвиги пиков h2’-H6 / H8 NOE (h2 ’или H6 / H8 Δδ> 0,025 м.д.) происходят в центральных остатках ATATATG (рис. 3E и 3F).

Чтобы подтвердить, что MvaT ctd связывает малую бороздку, мы провели конкурентный эксперимент с использованием нетропсина, природного олигопептида, который связывает малую бороздку АТ-богатой ДНК.При добавлении возрастающей концентрации нетропсина в образец 15 N-MvaT ctd , содержащий двукратный избыток 3AT, сигналы ЯМР MvaT ctd сместились из связанной с ДНК формы обратно в свободную форму. постепенно, что указывает на то, что комплекс MvaT ctd / ДНК был разрушен нетропсином в зависимости от концентрации. При соотношении нетропсин / ДНК 2,5: 1 спектр HSQC 2D 1 H- 15 N почти идентичен спектру свободного MvaT ctd , что указывает на то, что нетропсин почти полностью высвобождает MvaT ctd из 3AT.

Структура комплекса MvaT

ctd / ДНК раскрывает новый механизм связывания ДНК

В отличие от Lsr2 и H-NS [16, 29], ДНК-связанный MvaT ctd имеет единственный набор сигналов NH, и ни один из сигналов NH не исчезает при связывании ДНК (S2 рис.), Что позволяет нам определить решение структура MvaT ctd в комплексе с додекамером 3AT (рис. 4A). Структура комплекса MvaT ctd / 3AT была определена с использованием 3541 экспериментальных ограничений расстояния, включая 57 ограничений межмолекулярного расстояния, и среднеквадратичное отклонение тяжелого атома основной цепи 20 конечных структур с самыми низкими энергиями AMBER равно 0. 49 Å (таблица 1).

Рис. 4. Структура MvaT ctd и АТ-богатого комплекса ДНК.

(A) Наложение ансамбля из 20 структур комплекса MvaT ctd / ДНК. Белковый каркас представлен лентой, а целевая ДНК показана линиями. (B) Электростатический потенциал MvaT ctd , рассчитанный с помощью APBS в отсутствие ДНК. (C) Закройте окно привязки интерфейса. Остатки MvaT ctd , участвующие в распознавании ДНК, показаны в виде полосок с однобуквенным кодом аминокислоты и обозначенными номерами остатков.(D) Схематическое изображение межмолекулярных контактов. ДНК изображена в виде цилиндрической проекции, если смотреть со стороны малой бороздки. Водородные связи между MvaT ctd и основаниями ДНК указаны красными стрелками. Зеленые линии показывают гидрофобные контакты. Взаимодействия между положительно заряженными остатками лизина и фосфатными группами основной цепи ДНК показаны синими стрелками.

https://doi.org/10. 1371/journal.ppat.1004967.g004

Структура ДНК-связанного MvaT ctd почти такая же, как у свободного MvaT ctd , поскольку RMSD их основного тяжелого атома между среднее значение структур всего 0.90 Å. Основное различие состоит в том, что N-концевой участок становится более жестким, что согласуется с постепенным появлением сигнала ε-NH боковой цепи Arg80 при связывании с 3AT (S2B фиг.). Поверхность взаимодействия MvaT ctd положительно заряжена (рис. 4B) и имеет площадь поверхности 1,707 ± 14 Å 2 . Петля 2 MvaT ctd частично вставлена ​​в малую бороздку ДНК, при этом остов остатков Gly99 и Asn100 контактирует с парами оснований AT внизу, в то время как остатки Lys97 и Gly98 наклонены к вершине малой бороздки.Амиды основной цепи Gly99 и Asn100 образуют водородные связи с атомом O2 T19 и атомом N3 A18 соответственно. Боковая цепь Asn100 простирается вдоль малой бороздки, а его группа δ-NH 2 образует водородные связи с атомами O2 T9 и T17 (рис. 4C и 4D). Кроме того, боковая цепь Arg80 также вставляется в малую бороздку ДНК с ее гуанидиновой водородной группой, связанной с атомами O2 T5 и T21 (рис. 4C и 4D), и, таким образом, стабилизирует N-концевую область MvaT ctd .Боковые цепи Arg80 и Asn100 направлены друг от друга и занимают область, покрывающую все шесть пар оснований AT вместе с петлей 2. Таким образом, этому ДНК-связывающему мотиву было дано название «AT-pincer», поскольку интеркалирующие малые бороздки остатки происходят из двух разных петель MvaT ctd . Помимо взаимодействия с малой бороздкой ДНК, MvaT ctd также содержит шесть остатков лизина (Lys81, Lys83, Lys97, Lys102, Lys105 и Lys108), которые хорошо расположены для гидрофобных или электростатических контактов с сахарно-фосфатным остовом ДНК через боковые стороны. цепи метиленовых групп или ε-аминогрупп, соответственно (рис. 4C и 4D).Боковая цепь Lys81 стабилизируется при связывании 3AT, в то время как боковые цепи Lys83, Lys97, Lys102, Lys105 и Lys108 уже четко определены в структуре свободного MvaT ctd , поскольку эти боковые цепи лизина стабилизируются гидрофобными взаимодействиями с близлежащие остатки. Эта обширная сеть остатков лизина значительно увеличивает поверхность контакта с ДНК и является отличительной чертой MvaT ctd . Этот способ связывания AT-богатой ДНК явно отличается от режима связывания H-NS и Lsr2, которые разделяют общий механизм связывания ДНК через AT-крючковидный мотив (подробное сравнение в разделе «Обсуждение»).

При связывании MvaT ctd , малая канавка 3AT расширяется, а геометрия штабелирования основания значительно изменена. MvaT ctd -связанный 3AT показывает увеличенные углы поворота и наклона по сравнению со свободной ДНК-декамером d (GGATATATCC) 2 с той же центральной последовательностью ATATAT (PDB 2LWG [51]), ~ 9,6 ° и ~ 15,5 ° на шаг в среднее значение соответственно (рис. 5A), что указывает на то, что пары оснований локально изгибаются в направлении большой бороздки и, таким образом, открывают малую бороздку [49].Ширина малой бороздки 3AT, связанного с MvaT ctd , достигает минимума на средней ступеньке основания A 6 pT 7 и постепенно расширяется к каждому концу последовательности ATATAT. Боковые цепи Arg80 и Asn100 расположены на базовых ступенях A 4 pT 5 и A 8 pT 9 соответственно, где ширина малых канавок значительно увеличена по сравнению с шириной канавок в структуре 2LWG. Вышеупомянутые боковые цепи лизина хорошо подходят к основной цепи 3AT в комплексе MvaT ctd / ДНК, в то время как их конформации остаются аналогичными конформации в свободном белке.Таким образом, вероятно, что искажение дуплекса ДНК должно приспособиться к конформации этой «лизиновой сети». Напротив, ДНК A-тракта, как сообщается, обладает очень узкой малой бороздкой, а углы поворота и наклона последовательно малы или отрицательны [49, 52]. ДНК A-тракта также обнаруживает общий изгиб на ~ 15 ° в сторону малой бороздки [53], тогда как свободный и связанный с MvaT ctd 3AT почти прямой (Рис. 5B). Это может объяснить, почему MvaT не отдает предпочтение ДНК A-тракта, поскольку жесткая ДНК A-тракта не имеет благоприятной конформации для связывания MvaT.

Рис. 5. Анализ конформации ДНК, связанной с MvaT ctd .

(A) Выбранные параметры спирали структур раствора MvaT ctd -связанной ДНК 3AT (синий), свободной ДНК с последовательностью ATATAT (PDB 2LWG) (пурпурный) и ДНК A-тракта с последовательностью AAAAAA (PDB 1FZX [52]) (золото). Показаны средняя ширина малой канавки, углы валка и наклона, включая стандартные отклонения. Указаны базовые ступени 3AT. (B) Средние структуры MvaT ctd -связанных 3AT (синий), 2LWG (пурпурный) и 1FZX (золотой).Топоры показаны палками.

https://doi.org/10.1371/journal.ppat.1004967.g005

И «AT-клещи», и «лизиновая сеть» важны для связывания ДНК

Для изучения важности остатков, вовлеченных в структуру комплекса MvaT ctd / ДНК, мы создали серию мутантов MvaT ctd , содержащих замены R80A, K81A, K83A, K97A, N100A, K102A, K105A и K108A. Все эти мутации, за исключением K83A, не оказывают значительного влияния на общую структуру MvaT ctd , поскольку спектры 2D 1 H- 15 N HSQC этих мутантов аналогичны спектрам MvaT дикого типа (WT). ctd (S3 Рис).Поскольку сигналы NH для K83A полностью отличаются от сигналов WT MvaT ctd , мутация K83A, вероятно, привела к общему кратному изменению. Это указывает на то, что боковая цепь Lys83 играет важную роль в стабилизации структуры, поскольку она образует солевой мостик с Glu117, а его алифатические группы образуют гидрофобный контакт с Tyr85, Ala120 и Leu122.

Каждый мутант, за исключением K83A, затем титровали додекамером 3AT и оценивали с помощью ЯМР (S4 фиг.). Для мутантов K81A и K97A характер сдвига сигналов NH во время титрования ДНК весьма схож с таковыми для WT MvaT ctd с точки зрения масштаба и направления, что позволяет предположить, что две мутации не должны оказывать значительного влияния на связывание ДНК MvaT . ctd .Мутанты R80A, K102A демонстрируют пониженные изменения химического сдвига, но с аналогичными направлениями сдвига сигналов NH, что и у WT MvaT ctd . Мутации N100A, K105A и K108A оказывают наиболее сильное влияние на паттерны возмущения сигнала NH, вызванные 3AT, с гораздо меньшими изменениями химического сдвига NH, а некоторые направления сдвига сигналов NH сильно отличаются от таковых у WT MvaT ctd , что указывает на то, что эти мутации могут значительно нарушают режим связывания ДНК MvaT ctd .

Были проведены эксперименты

ITC для характеристики аффинности связывания между ДНК и MvaT ctd или его мутантами (фиг. 6A и S5). Как и ожидалось, WT MvaT ctd проявляет наивысшее сродство к 3AT, с K d около 10,7 мкМ. Аффинность связывания для мутантов R80A и K108A более чем в 10 раз слабее, чем WT MvaT ctd , тогда как значения K d мутантов N100A и K105A увеличиваются более чем в 3 раза.Напротив, мутации K81A, K97A и K102A только приводят к немного более низкому сродству связывания ДНК ( K d увеличивается на ~ 70%).

Рис. 6. Характеристика мутантов MvaT.

(A) Константы диссоциации для WT MvaT ctd и его мутантов при связывании с 3AT, измеренные с помощью ITC. Планки погрешностей представляют собой стандартное отклонение. (B) Фенотипы штаммов cupA lacZ , содержащих плазмиды, управляющие экспрессией WT MvaT или его мутантов (верхняя панель). Фазово-изменяющаяся экспрессия генов cupA может быть репрессирована путем предоставления гена mvaT в транс, что приводит к образованию белых колоний. Производная с функционально нарушенным MvaT дает рост колоний синего (фаза ВКЛ) и белого цвета (фаза ВЫКЛ). Вестерн-блоттинг с антителом против метки VSV-G (нижняя панель). Контроль загрузки образца вестерн-блоттинга исследуют антителом против α-субъединицы РНК-полимеразы. (C) Количественная оценка экспрессии cupA lacZ в культурах штаммов, содержащих WT MvaT или его мутанты.Планки погрешностей представляют собой стандартное отклонение среднего (n = 3).

https://doi.org/10.1371/journal.ppat.1004967.g006

MvaT ctd связывается с GC-богатой ДНК, d (CGCGCGCG) 2 дуплекс, с гораздо более слабым сродством ( K d ~ 360 мкМ) (S5I Рис.). Примечательно, что WT MvaT ctd и его мутанты связываются с АТ-богатой ДНК эндотермическим образом, указывая на то, что связывание является процессом, управляемым энтропией. Было высказано предположение, что большое положительное изменение энтальпии связано с десольватацией малой бороздки ДНК и искажением дуплекса ДНК, как мы наблюдали в комплексе MvaT ctd / ДНК [54].Благоприятное изменение энтропии можно объяснить смещением высокоупорядоченных молекул воды в малой бороздке ДНК [55]. Напротив, связывание MvaT ctd с GC-богатой ДНК управляется как энтальпией, так и энтропией, что позволяет предположить, что MvaT связывает GC-богатую ДНК совершенно другим способом.

Мутанты MvaT со значительно пониженной аффинностью связывания ДНК функционально нарушены

Затем мы проверили, важны ли те остатки MvaT, которые участвуют в связывании ДНК, для функции MvaT в клетках P . aeruginosa . Ранее было показано, что MvaT в P . aeruginosa репрессирует изменяющуюся по фазе экспрессию фимбриальных генов cupA [23]. В штамме PAO1 ΔmvaT cupA1 lacZ , где ген lacZ расположен ниже хромосомного гена cupA1 , гены cupA экспрессируются изменчивым по фазе образом, что проявляется появлением синих и белых колоний. на чашках с агаром LB, которые содержат хромогенный субстрат 5-бром-4-хлор-3-индолил-β-D-галактопиранозид (X-Gal).Это обратимое включение-выключение экспрессии гена cupA , наблюдаемое в клетках мутантного штамма ΔmvaT , может быть репрессировано путем предоставления гена mvaT в транс, приводящего к образованию белых колоний на чашках с агаром LB, содержащим X-Gal [23 ].

Чтобы проверить, могут ли мутанты MvaT, содержащие замены R80A, K81A, K83A, K97A, N100A, K102A, K105A и K108A, репрессировать фазово-переменную экспрессию фимбриальных генов cupA так же эффективно, как MvaT WT, мы ввели в клетки репортера плазмиды штамма PAO1 ΔmvaT cupA lacZ , управляющие синтезом либо WT MvaT, либо мутанта MvaT, каждая из которых содержит эпитопную метку гликопротеина вируса везикулярного стоматита (VSV-G) на своем С-конце.Затем клетки выращивали на чашках с агаром LB, содержащем X-Gal. Вестерн-блоттинг с использованием антитела против метки эпитопа VSV-G показал, что все белки были произведены в сопоставимых количествах, за исключением K105A, который был немного менее обильным, чем другие (рис. 6B).

В отличие от WT MvaT, содержащего метку эпитопа VSV-G (MvaT-V), мутанты MvaT-V R80A, K83A, N100A, K105A и K108A не смогли репрессировать фазово-переменную экспрессию репортера cupA lacZ (рис. 6B). Напротив, мутанты MvaT-V K81A, K97A и K102A могли репрессировать активность cupA , аналогично WT MvaT-V.Для дальнейшего выяснения влияния вариантов MvaT-V на репрессию cupA , экспрессию lacZ количественно определяли в клетках, выращенных в жидкой культуре, с помощью анализа β-галактозидазы. Это подтвердило, что варианты MvaT-V K81A, K97A и K102A могут репрессировать активность cupA так же, как и WT MvaT-V (фиг. 6C). Из мутантов MvaT-V, которые не смогли репрессировать cupA , вариант R80A был наиболее сходен с контролем с пустым вектором и, следовательно, наиболее дефектен, тогда как мутант K105A был наименее дефектным.Поскольку замена K105A, по-видимому, снижает количество MvaT-V, возможно, что сниженная способность мутанта K105A подавлять фазово-изменяющуюся экспрессию генов cupA может частично объясняться эффектами этой замены на изобилие белка. . Нарушение функции варианта K83A, вероятно, является результатом изменения укладки белка, как обсуждалось выше. У обоих мутантов N100A и K108A была значительно нарушена их способность подавлять экспрессию cupA в одинаковой степени (фиг. 6C).Эти находки демонстрируют, что мутанты MvaT, которые проявляют заметно сниженную аффинность связывания ДНК in vitro , следовательно, имеют функциональное нарушение in vivo .

Обсуждение

В этом исследовании мы выполнили всесторонний анализ свойств связывания ДНК и механизма ксеногенного глушителя MvaT от условно-патогенного микроорганизма P . aeruginosa . Мы продемонстрировали, что MvaT имеет более высокое сродство связывания с богатой АТ геномной ДНК-мишенью по сравнению с нецелевой ДНК, богатой GC.Кроме того, MvaT связывает свою целевую ДНК с гораздо меньшей скоростью, что также должно способствовать его селективности в отношении целевой ДНК. Данные PBM показывают, что MvaT в целом имеет сходные предпочтения последовательностей ДНК с H-NS и Lsr2. Однако также обнаружено, что MvaT предпочитает AT-богатые последовательности с множественными стадиями TpA и имеет значительную устойчивость к прерываниям пары оснований GC, что является уникальным для MvaT. Наши структурные и функциональные данные показывают, что MvaT использует новый механизм распознавания ДНК, богатый AT, отличный от H-NS и Lsr2, для выполнения функции ксеногенного сайленсинга.

Хотя аффинность связывания ДНК одного ДНК-связывающего домена относительно низка (~ 10 мкМ), полноразмерный MvaT связывает свою геномную AT-богатую целевую ДНК с гораздо более высокой аффинностью из-за поливалентного эффекта, поскольку полноразмерный MvaT олигомеризуется в растворе через свои N-концевые домены [30], и, таким образом, он связывает целевую ДНК, содержащую несколько сайтов связывания, в виде олигомера с несколькими доменами связывания ДНК. В результате энергия связывания каждой полноразмерной молекулы MvaT в нуклеопротеидном комплексе на ДНК определяется не только ее взаимодействием с ДНК, но также ее взаимодействием с соседними молекулами ДНК-связанного MvaT (опосредованного через их N-конец домены), что значительно увеличивает общую стабильность комплекса. Многовалентное взаимодействие широко распространено в биологии хроматина [56], а также используется другими ксеногенными сайленсерами. Значения K d для H-NS ctd (~ 9 мкМ) и Lsr2 ctd (~ 4 мкМ) для связывания 3AT ДНК аналогичны таковым для MvaT ctd [29], тогда как их полноразмерные белки также связывают ДНК с гораздо более высоким сродством [33, 57]. Мультивалентное связывание, состоящее из индивидуального слабого взаимодействия, более восприимчиво к конкуренции, чем может быть моновалентное сильное связывание [58], что облегчает противодействующим сайленсерам, таким как Ler, ослабление репрессии ксеногенных сайленсеров в регуляции экспрессии генов [59] ].

Структура MvaT ctd в комплексе с ДНК 3AT показывает, что ДНК-связывающий домен MvaT распознает богатую AT ДНК как через мотив «AT-pincer», вставленный в малую бороздку ДНК, так и через «сеть лизина» с множественными положительными заряды, взаимодействующие с фосфатами остова ДНК. MvaT лишен AT-крючкообразного мотива «Q / RGR», который является критическим для связывания ДНК как H-NS, так и Lsr2, хотя все они специфически нацелены на малую бороздку AT-богатой ДНК. Прогнозы гомологии показывают, что MvaT может иметь структурное сходство с белками семейства H-NS, обнаруженными в Xanthomonadaceae , включая патоген растений Xylella fastidiosa .Выравнивание ДНК-связывающего домена MvaT с разнообразным набором членов семейства H-NS показывает, что MvaT имеет сходство с некоторыми гомологами H-NS в областях, непосредственно N-концевых по отношению к каноническому мотиву H-NS (TW (S / T) G (Q / R) GRTP). Канонический мотив, однако, заменяется другой последовательностью (VIETKGGNH), которая высококонсервативна среди MvaT-подобных белков и отсутствует у членов семейства H-NS (рис. 7A).

Рис. 7. Выравнивание последовательностей и структурное сравнение MvaT ctd с AT-крючкообразным мотивом, содержащим ДНК-связывающие домены.

(A) Сопоставление Pseudomonas MvaT с членами семейства H-NS выявляет области сходства за пределами канонического мотива H-NS. Выравнивание Clustal Omega С-концевых доменов MvaT и MvaU из P . aeruginosa PAO1 с Bv3F из Burkholderia vietnamiensis G4 (Buv), H-NS из S . typhimurium (Sal), Xanthomonas albilineans (Xan) и X . fastidiosa (Xyl) и Lsr2 из M . Туберкулез . Канонический мотив H-NS заключен в рамку. Жирным шрифтом выделены остатки, соответствующие АТ-крючковому мотиву в Lsr2 и H-NS. (B) Наложение структур MvaT ctd (голубой) и S . typhimurium H-NS ctd (пурпурный). Конформации боковой цепи K97 и N100 MvaT ctd почти идентичны таковым у T110 и R114 H-NS ctd , соответственно. MvaT ctd не имеет соответствующего остатка Q112, функционирующего как первый критический остаток AT-крючкообразной структуры «Q / RGR» в H-NS ctd .Когда MvaT ctd образует комплекс с ДНК, боковая цепь R80 занимает такое же положение, что и боковая цепь Q112 из H-NS ctd . Голубой кружок показывает разрыв между боковой цепью R80 и основой loop2. (C) MvaT ctd / структура комплекса ДНК, если смотреть с одного конца двойной спирали. Полость над парой оснований A6-T19 показана красными сферами.

https://doi.org/10.1371/journal.ppat.1004967.g007

Общая складка MvaT ctd аналогична складке H-NS ctd , хотя относительная ориентация спиралей и β-листа для этих двух белков различны (рис. 7B).Петля 2 MvaT ctd , содержащая последовательность (KGGNH), на два остатка короче, чем соответствующая петля H-NS ctd , в которую встроен AT-крючкообразный мотив «Q / RGR» (фиг. 7A и 7B). ). Первый недостающий остаток в MvaT соответствует связыванию малой бороздки «Q / R» мотива «Q / RGR». АТ-крючкообразные мотивы H-NS и Lsr2 вставляются в малую бороздку ДНК, принимая плоскую конформацию с боковыми цепями первого «Q / R» и последнего «R» остатков, вытянутыми в противоположном направлении параллельно второму. паз пол.Однако после связывания MvaT ДНК только Gly99 и Asn100 петли 2 вставляются в малую бороздку и образуют водородные связи с основаниями. Боковая цепь Asn100 имеет такую ​​же конформацию, как последний аргинин мотива «Q / RGR», и, таким образом, остатки MvaT Gly99 и Asn100, по-видимому, функционируют как половина структуры АТ-крючка. Интересно, что роль отсутствующего первого остатка «Q / R» в AT-крючковидном мотиве компенсируется боковой цепью Arg80 из N-концевой области MvaT ctd , что, таким образом, позволяет MvaT распознавать AT -обогатая малая бороздка ДНК с мотивом «AT-клешня», состоящим из остатков Arg80 и Gly99-Asn100.В результате на границе раздела белок / ДНК имеется полость с минимальным радиусом на 1,2 Å выше пары оснований A6-T19 (рис. 7B и 7C), рассчитанная с помощью CAVERS [60], которая теоретически могла бы вместить экзоциклический NH . 2 из пары оснований GC. Это должно объяснять более высокую толерантность MvaT к прерываниям пар оснований GC, как показали наши данные PBM, поскольку малая бороздка ДНК почти полностью занята AT-крючковидными мотивами H-NS и Lsr2.

Недавно было высказано предположение, что как прямое (считывание оснований), так и непрямое (считывание формы) считывание ДНК важно для распознавания ДНК для большинства ДНК-связывающих белков [61, 62].В то время как мотив «AT-клещи» MvaT вставляется в малую бороздку и обеспечивает считывание оснований, боковые цепи нескольких остатков лизина (остатки 81, 83, 97, 102, 105 и 108) MvaT взаимодействуют с сахаром ДНК. фосфатный каркас и представляют собой считывание формы малой канавки. Исследования мутагенеза показывают, что как мотив «AT-pincer», так и «лизиновая сеть» важны для аффинности связывания ДНК MvaT ctd . Наш функциональный анализ также показывает, что точечная мутация остатка Arg80 или Asn100 мотива «клещей AT», а также остатка Lys105 или Lys108 «лизиновой сети» нарушает функцию MvaT по репрессии фазовой переменной экспрессии cupA. lacZ репортер.Структурное сравнение свободного и связанного с ДНК MvaT ctd показывает, что большинство ключевых боковых цепей лизина не меняют своей конформации при связывании ДНК, в то время как 3AT принимает почти прямую конформацию с его малой бороздкой, расширенной для связывания MvaT. Это может объяснить, почему MvaT отдает предпочтение гибким последовательностям ДНК с несколькими ступенями TpA по сравнению с ДНК A-тракта. Хорошо известно, что ДНК А-тракта более жесткая и по своей природе изогнута на ~ 15 ° в сторону малой бороздки [49, 53], и поэтому для ДНК А-тракта было бы энергетически затратно открыть свою малую бороздку и принять благоприятная конформация для связывания MvaT.

Заметны различия в искажении ДНК при связывании MvaT и H-NS / Lsr2. Искажение незначительной бороздки наиболее ярко иллюстрируется эукариотическим связывающим белком ТАТА (TBP), который открывает малую бороздку, чтобы раскрутить двойную спираль примерно на 120 °, и сжимает большую бороздку, изгибая ДНК почти на 80 °. Критическим параметром для связывания TBP является не последовательность как таковая, а, скорее, присущая стадия TpA гибкость, которая позволяет белку резко открывать малую бороздку и устанавливать обширные контакты как с фосфатным остовом, так и с основаниями, составляющими основание паз. Искажения, запускаемые в ДНК при связывании с MvaT, значительны, хотя и относительно малы по сравнению с TBP. На другом полюсе находятся эукариотические белки HMG-I (Y), которые содержат узкие и гибкие мотивы АТ-крючка, каждый из которых состоит из мотива R-G-R-P. AT-крючок образует узкую структуру в форме полумесяца, которая вставляется в малую бороздку без значительного искажения траектории спирали [63], что, вероятно, имеет место для H-NS и Lsr2 при связывании ДНК с их AT-крючковидными мотивами.Режим связывания ДНК MvaT наименее похож на Lsr2, который предпочитает ДНК A-тракта с узкой малой бороздкой и в значительной степени нечувствителен к ступеням TpA.

Среди трех семейств бактериальных ксеногенных сайленсеров H-NS и Lsr2 имеют общий механизм распознавания ДНК, похожий на AT-крючок, даже несмотря на то, что они структурно различаются, в то время как последовательность и структурное сходство между MvaT и H-NS предполагают, что они могут иметь общий общее эволюционное происхождение. Любопытно, что MvaT использует особый способ связывания для распознавания сходных, но не идентичных мишеней последовательностей ДНК.Геномный анализ предполагает, что ксеногенные последовательности часто демонстрируют более высокое содержание AT по сравнению с геномом хозяина [64]. Однако среднее содержание AT по всему геному для разных родов бактерий может сильно отличаться, например, ~ 48% для E . coli и S . typhimurium и ~ 34% для M . tuberculosis и P . aeruginosa . Ранее мы сообщали, что доля связанной последовательности из данных ChIP-on-Chip начинает увеличиваться, когда содержание AT достигает ~ 50% для H-NS из S . typhimurium и ∼38% для Lsr2 из M . tuberculosis , которые соответствуют среднему содержанию АТ в соответствующем геноме соответственно [29]. Что еще интереснее, H-NS от S . typhimurium и Lsr2 из M . tuberculosis демонстрируют почти идентичные паттерны связывания, когда содержание АТ в связанной последовательности нормализовано относительно среднего содержания АТ соответствующего генома. Мы предположили, что мотив «RGR» в виде крючка AT используется в основном в ксеногенных глушителях из M . tuberculosis (Lsr2) и B . vietnamiensis (Bv3F), оба с геномами с низким содержанием AT, обеспечивают более прочное связывание с последовательностями с относительно более низким содержанием AT [29]. Для сравнения, мотив «QGR» в виде крючка AT в H-NS из S . тифимуриум и E . coli , оба с геномами с высоким содержанием AT, имеют более низкое сродство к ДНК, слегка богатой AT. Неожиданно оказалось, что аффинность связывания ДНК ДНК-связывающего домена MvaT из P . aeruginosa ниже, чем у Lsr2 из M . tuberculosis , оба с аналогичными геномами с низким содержанием AT, в то время как он аналогичен геному H-NS из S . typhimurium с геномом с высоким содержанием AT. Наши биохимические и структурные исследования показали, что MvaT предпочитает гибкие последовательности ДНК с несколькими стадиями TpA и может лучше переносить вставку GC в последовательности, богатые AT. Из этого может следовать, что Pseudomonas развил MvaT со значительной GC-устойчивостью, чтобы справиться с его геномом с низким содержанием AT.Также возможно, что конкретные особенности, такие как ступени TpA, недостаточно представлены в «основном» геноме Pseudomonas по сравнению с мобильным геномом. До сих пор неясно, почему MvaT из Pseudomonas использует другое решение, чтобы отличить чужеродную ДНК от собственной, и детерминанты могут лежать в подробных характеристиках последовательности его генома.

В то время как предыдущие исследования были в основном сосредоточены на выявлении функционального сходства ксеногенных глушителей от разных бактерий, их различия в значительной степени игнорируются.Очевидно, что способность ксеногенных сайленсеров различных бактерий отличать чужеродные ДНК от собственных ДНК должна зависеть от среднего содержания AT в их соответствующих геномах, и даже возможно, что эти ксеногенные сайленсеры должны точно настраивать свои свойства связывания ДНК. чтобы справиться с различными характеристиками последовательностей собственных геномов и чужеродных ДНК. Необходимы дополнительные исследования для дальнейшего изучения корреляции между молекулярными механизмами ксеногенных глушителей из разных бактерий и характеристиками их геномов.

Материалы и методы

Штаммы бактерий и химикаты

П . aeruginosa штамм PAO1 Δ mvaT cupA lacZ был описан ранее [23]. Е . coli DH5αF’IQ (Invitrogen) использовали в качестве штамма-реципиента для всех плазмидных конструкций. Е . coli штамм BL21 (DE3) использовали для очистки белка.

При выращивании Р . aeruginosa , гентамицин использовали в концентрации 25 мкг / мл для жидких культур и 30 мкг / мл для твердых сред.Колонии репортерного штамма с включенной и выключенной фазой визуализировали после роста на агаре LB, содержащем 75 мкг / мл X-Gal.

Подготовка проб для ЯМР

Последовательность ДНК

, кодирующая С-концевой домен MvaT (остатки 77–124) из P . aeruginosa субклонировали в вектор pET21b непосредственно перед кодирующей последовательностью His 6 -tag. Точечные мутации генерировали с использованием набора для сайт-направленного мутагенеза (SBS Genetech). Е . coli BL21 (DE3), несущий плазмиду, культивировали в среде LB при 35 ° C, и белок был сверхэкспрессирован путем индукции 100 мкМ IPTG до тех пор, пока OD 600 > 1,0. Для изотопного мечения 15 N и 13 C бактерии сначала выращивали в среде LB до OD 600 > 0,9, затем собирали и ресуспендировали в 15 N, 13 C-меченой минимальной среде M9 для продолжения роста, и добавляли 100 мкМ IPTG для индукции экспрессии белка через 40 мин.Клетки собирали центрифугированием через 9 ч после индукции и ресуспендировали в буфере для лизиса (50 мМ Трис-HCl, 1 М NaCl, 20 мМ имидазол, pH 9,0), затем лизировали путем замораживания и оттаивания с последующей обработкой ультразвуком. После центрифугирования супернатант, содержащий слитый белок, меченный His, наносили на аффинную колонку Ni-NTA (Qiagen) и элюировали элюирующим буфером (50 мМ Tris-HCl, 1 M NaCl, 250 мМ имидазол, pH 9,0). Белок дополнительно очищали с помощью эксклюзионной хроматографии на колонке superdex 75 (Amersham) в 50 мМ фосфате натрия с 50 мМ NaCl (pH 6.0). Образцы ДНК получали гибридизацией самокомплементарных олигонуклеотидов, сначала нагревали до 94 ° C в течение 5 минут, а затем отжигали путем медленного охлаждения до комнатной температуры. Образцы комплекса белок / ДНК получали смешиванием дуплекса белка и ДНК в соотношении 1: 1.

Отнесения резонанса ЯМР

Образец ЯМР свободного MvaT ctd содержал ~ 1 мМ однородно 15 N, 13 C — меченый белок в 50 мМ фосфате натрия, 50 мМ NaCl (pH 6,0) с 90% H 2 O / 10 % D 2 O вместе с 0.01% NaN 3 и 0,01% DSS. ЯМР-образец комплекса MvaT ctd / ДНК содержал ~ 1 мМ 1: 1 комплекс однородно 15 N, 13 C-меченого белка и немеченой ДНК в том же буфере. Все спектры ЯМР были получены при 298 К на спектрометрах Bruker Avance 600, 700 или 800 МГц, оборудованных криозондами тройного резонанса. Химические сдвиги протонов были привязаны непосредственно к DSS. Химические сдвиги 15 N и 13 C были косвенно связаны с DSS.Резонансы основной цепи и алифатической боковой цепи были присвоены 2D 1 H- 15 N HSQC, 2D 1 H- 13 C HSQC, 3D HNCACB, 3D CBCA (CO) NH, 3D HNCO, 3D HBHA (CBCA ) (CO) NH, 3D (H) CCH-COSY, 3D (H) CCH-TOCSY и 3D H (C) CH-TOCSY. Ароматические резонансы были назначены с использованием 3D 1 H- 13 C-edited-NOESY, оптимизированного для ароматических резонансов. Резонансы ДНК в комплексе с MvaT ctd были назначены с использованием 2D F1, F2- 15 N / 13 C-профильтрованный спектр NOESY.Существует единый набор резонансов для двух цепей палиндромного дуплекса 3AT для образца комплекса MvaT ctd / ДНК, что указывает на то, что процесс связывания происходит быстро по шкале времени ЯМР. Свободные резонансы ДНК были отнесены к спектрам 2D 1 H TOCSY и 2D 1 H NOESY. Данные были обработаны с помощью NMRPipe [65] и проанализированы с помощью ЯМР View [66].

Эксперименты по ЯМР-титрованию

Все образцы ЯМР, использованные для эксперимента по титрованию ДНК, равномерно содержали 0,1 мМ 15 N меченого белка в 50 мМ фосфате натрия, 50 мМ NaCl (pH 6.0) с 90% H 2 O / 10% D 2 O. Серия 2D 1 H- 15 N HSQC спектров с постепенно увеличивающейся концентрацией ДНК (0,02 мМ, 0,04 мМ, 0,08 мМ, 0,12 мМ, 0,16 мМ и 0,2 мМ) собирали при 298 К на спектрометре Bruker Avance 500 МГц с криозондом тройного резонанса и анализировали изменения химических сдвигов.

2D 1 H Эксперименты NOESY были проведены для исследования возмущений химического сдвига для ДНК-дуплекса d (CGCATATATGCG) 2 образцов с MvaT ctd или без него на спектрометре Bruker Avance 800 МГц, оборудованном криозондом при 298 К.Образец ЯМР содержал 0,4 мМ ДНК в 50 мМ фосфате натрия, 50 мМ NaCl (pH 6,0) со 100% D 2 O и лиофилизированный протеиновый порошок MvaT ctd добавляли до конечных концентраций 0,25 и 0,5 мМ. Анализировали область отпечатков пальцев внутриостаточных кросс-пиков h2’-H6 / H8 NOE.

Для эксперимента по конкуренции с нетропсином равномерно 0,1 мМ 15 N, меченный MvaT ctd был смешан с 0,2 мМ дуплексом ДНК в 50 мМ фосфате натрия, 50 мМ NaCl (pH 6,0) с 90% H 2 O / 10% D 2 О.2D 1 H- 15 N Спектры HSQC были получены с постепенным добавлением нетропсина в концентрациях 0,05 мМ, 0,1 мМ, 0,2 мМ, 0,3 мМ и 0,5 мМ на спектрометре Bruker Avance 500 МГц с криозондом тройного резонанса. .

Определение структуры

Ограничения расстояния были получены из 3D 1 H- 15 N-отредактированных NOESY-HSQC и 3D 1 H- 13 C-редактированных экспериментальных данных NOESY-HSQC. Межмолекулярные NOE были получены из 3D F1- 15 N / 13 C-фильтрация, F2- 13 C-редакция NOESY и 2D F1- 15 N / 13 C-фильтрация, F2- 15 N-редактируемые спектры NOESY. Дополнительные межмолекулярные NOE были получены путем анализа спектров NOESY-HSQC 3D 1 H- 15 N-редакции и 3D 1 H- 13 C-редакции NOESY-HSQC комплекса MvaT ctd / ДНК. Белковые ограничения по двугранному углу были получены с использованием TALOS + [67]. Ограничения на боковую цепь χ — 1 угол были выведены на основе внутриостаточных паттернов NOE.

Для расчета структуры свободного MvaT ctd исходные структуры были сгенерированы CYANA с ограничениями из модуля CANDID [68].Затем исходные структуры использовались в качестве моделей фильтров для уточнения присвоений NOE и ограничений расстояния с помощью SANE [69]. Эти уточненные ограничения расстояния затем использовались для расчета уточненных структур с модулем DYANA CYANA. Эта процедура выполнялась итеративно, поскольку уточненные структуры могут использоваться в качестве моделей фильтров для следующего раунда расчета SANE-DYANA. Когда не было нарушения расстояния более 0,5 Å, 100 структур с наименьшими значениями целевой функции из 200 структур, рассчитанных с помощью DYANA, были отобраны для дальнейшего уточнения с использованием AMBER 12 [70] с использованием обобщенной модели сольватации Борна (GB) [71]. SANE также использовался для процесса уточнения до тех пор, пока практически не было нарушения расстояния более 0,2 Å и нарушения угла не было больше 5 °. Для представления были выбраны 20 лучших структур с наименьшими энергиями AMBER, средняя структура была получена с использованием SUPPOSE и минимизация энергии с помощью AMBER 12. Качество структур было проанализировано с помощью PROCHECK-ЯМР [72].

Для расчета сложной структуры сначала рассчитывались и уточнялись структуры MvaT ctd и ДНК отдельно, как описано выше.В дополнение к ограничениям расстояния NOE, теоретические ограничения для B-формы ДНК также использовались при определении структуры ДНК. Углы скручивания основной цепи ДНК α, β, γ, δ, ε и ζ были ограничены диапазонами -60 ° ± 30 °, 180 ° ± 30 °, 60 ° ± 35 °, 130 ° ± 50 °, 225 ° ± 75 ° и -95 ° ± 35 ° (или 180 ° ± 30 °) соответственно. Сморщивание сахара фиксировали на C2’-endo, устанавливая фазовый угол P псевдовращения в диапазоне 135 ° ± 45 °, как реализовано в программе AMBER. Угол гликозидного кручения χ был установлен на антиконформацию со значением -120 ° ± 40 °.Водородные связи использовали для поддержания типичного спаривания оснований Уотсона-Крика. Структура комплекса белок / ДНК была получена и дополнительно уточнена в AMBER 12 с использованием модели сольватации GB путем объединения MvaT ctd и структур ДНК с межмолекулярными ограничениями NOE. Вкратце, координаты белка и ДНК были произвольно объединены, и сложная структура была рассчитана с добавлением ограничений межмолекулярного расстояния, которые были установлены на 50 Å, и постепенно уменьшались до 20 Å и 8 Å, а затем до фактического удерживающего расстояния, в то время как Вес для ограничения межмолекулярного расстояния был увеличен с 0 до 2 до 20 до 25 ккал / моль · Å 2 .Из 100 рассчитанных структур были отобраны и проанализированы с помощью PROCHECK-ЯМР 20 структур с наименьшей энергией AMBER. Средняя структура была получена с использованием SUPPOSE, а энергия минимизирована с помощью AMBER 12. Параметры спирали и бороздок ДНК анализировали с помощью программы CURVES + [73].

Анализ сдвига электрофоретической подвижности

Фрагмент cupA1 размером 340 п.н. амплифицировали с помощью ПЦР из P . aeruginosa геномная ДНК PAO1 с использованием праймеров GT044 (5 ’GCGAAGCCGTGGTTCGAGTTGTT) и GT045 (5’ ATCCCGGCCTCTCTTGCTTGTCTT).Фрагмент гена PA3900 размером 204 п.н. амплифицировали с помощью ПЦР из той же геномной ДНК с использованием праймеров GT049 (CCGCAGGTGGCTGAACA) и GT050 (CGAATGCGGTGCGTTGATGG). Продукты ПЦР радиоактивно метили на 5′-конце γ- 32 P АТФ с использованием полинуклеотидкиназы Т4 (New England Biolabs). Фрагмент ДНК 400 нМ, 4 мкл γ- 32 P АТФ (3000 Ки / ммоль, 10 мКи / мл, Perkin Elmer), 1x полинуклеотидкиназный буфер и фермент полинуклеотидкиназа Т4 (New England Biolabs) инкубировали в общей сложности 40 мкл при 37 ° C в течение 30 мин.Реакцию останавливали добавлением 1 мкл 0,5 М EDTA, и избыток радиоизотопов удаляли с помощью спин-колонки G-25 (GE Healthcare Life Sciences). Смолу спин-колонки ресуспендировали путем встряхивания колонки вверх дном в течение 30 секунд. Колпачок ослабили на четверть оборота и отломили нижнюю крышку. Затем колонку помещали в микроцентрифужную пробирку на 1,5 мл и вращали со скоростью 2800 об / мин (735g) в настольной центрифуге. Затем колонку помещали в свежую микроцентрифужную пробирку на 1,5 мл и проводили реакцию радиоактивного мечения.ДНК элюировали вращением при 2800 об / мин (735 × g) в течение 2 мин в настольной центрифуге. 760 мкл H 2 O добавляли к конечному объему 800 мкл для разбавления ДНК до рабочего запаса 20 нМ. ДНК разделяли на аликвоты и хранили при -20 ° C. 1 мкл этого исходного раствора даст конечную концентрацию 1 нМ в 20 мкл реакции связывания EMSA. 1 нМ радиоактивно меченую ДНК инкубировали с различными концентрациями белка в связывающем буфере (15 мМ HEPES pH 7,9, 40 мМ KCl, 1 мМ EDTA, 0,5 мМ DTT, 5% глицерин). Добавление различных количеств белка изменяло концентрацию растворенных веществ от пробирки к пробирке. Таким образом, буферные условия были нормализованы так, что каждая реакция содержала 8 мМ Трис pH 8,0, 15 мМ HEPES pH 7,9, 40 мМ NaCl, 40 мМ KCl, 1,4 мМ EDTA, 0,5 мМ DTT, 9,95% глицерина. Реакции связывания инкубировали при комнатной температуре в течение 15 мин перед добавлением избытка холодной (немеченой) ДНК, где это необходимо. Далее образцы инкубировали еще 15 мин при комнатной температуре. 2,5 мкл 10-кратного красителя для загрузки ДНК (10 мМ Трис-HCl, pH 7,5, 10 мМ ЭДТА, 65% сахарозы, 0,3% бромфенолового синего) добавляли в каждую реакцию, и образцы наносили на 6% природный полиакриламидный гель, который предварительно подвергали обработке. работать в течение 1 часа при 100 В при 4 ° C.Образцы обрабатывали при 70 вольт в течение 165 минут при 4 ° C, сушили в сушилке для геля (Labnet International) в течение 1 часа при 80 ° C и экспонировали в течение ночи на люминофорном экране хранения (GE Healthcare Life Sciences / Molecular Dynamics). Гели визуализировали на следующее утро с помощью тепловизора Typhoon 9400 с разрешением изображения 50 мкм. Кажущуюся константу диссоциации, которая соответствует концентрации белка, когда ДНК наполовину связана, определяли с помощью аппроксимации кривой на основе количественной оценки интенсивности полос несвязанной ДНК.Сообщается среднее значение четырех повторов и их стандартные ошибки.

Микроматрица связывания белков

экспериментов с PBM проводили, как описано ранее [29]. Последовательность кодирования полной длины MvaT из P . aeruginosa клонировали в вектор pTH6838 [74] с использованием метода изотермической сборки [75] для создания вектора, продуцирующего химерный белок с глутатион-S-трансферазой (GST), присоединенным к N-концу MvaT. Данные были проанализированы с помощью специального скрипта Python (написанного и доступного от W.W.N) и построены с помощью пакета визуализации данных ggplot2 [76].

Калориметрия изотермического титрования

Эксперимент

ITC проводили с использованием системы MicroCal iTC200 (GE Healthcare) при 283 К. 0,15 мМ ДНК помещали в клетку и титровали MvaT ctd или его мутантами (2,3–4,2 мМ), введенными аликвотами по 2,4 мкл. Соответствующие контроли «от белка к буферу» были выполнены для коррекции фона. Данные титрования ITC анализировали с помощью Origin 7.0 (OriginLab), поставляемого с прибором.Стандартное отклонение рассчитывалось в соответствии с подгонкой по Origin.

Анализ β-галактозидазы

Ячейки П . aeruginosa были проницаемы с помощью додецилсульфата натрия и CHCl 3 и проанализированы на активность β-галактозидазы, как описано ранее [77]. Анализы выполняли дважды в трех экземплярах в отдельных случаях. Показан репрезентативный набор данных.

Мутантные векторы экспрессии MvaT-V

Плазмида pPSV-MvaT-V, которая обеспечивает экспрессию WT MvaT с С-концевой меткой гликопротеинового эпитопа вируса везикулярного стоматита (MvaT-V), была описана ранее [30].Сайт-направленный мутагенез mvaT выполняли с помощью ПЦР для введения мутаций, определяющих аминокислотные замены R80A, K81A, K83A, K97A, N100A, K102A, K105A и K108A. Мутантные кодирующие последовательности расщепляли с помощью Bam HI и Xho I и клонировали в pPSV-MvaT-V, разрезанную теми же ферментами, для получения плазмид pPSV-MvaT (R80A) -V, pPSV-MvaT (K81A) -V, pPSV-MvaT (K83A) -V, pPSV-MvaT (K97A) -V, pPSV-MvaT (N100A) -V, pPSV-MvaT (K102A) -V, pPSV-MvaT (K105A) -V и pPSV-MvaT (K108A) ) -V.

Вестерн-блоттинг

Продукция белков MvaT-V была подтверждена вестерн-блоттингом с использованием антитела против VSV-G (Sigma-Aldrich). Антитело против α-субъединицы РНК-полимеразы (Neoclone) использовали для контроля различий в загрузке белка.

Вспомогательная информация

S1 Рис. Структурные параметры, предсказанные DNAshape для MvaT-связанных 100% AT 8-мерных последовательностей с максимальными 20 (левая панель) и самыми низкими 20 (правая панель)

E -баллами.

Параметры спирали не рассчитываются для двух оснований на обоих концах 8-мерной последовательности.

https://doi. org/10.1371/journal.ppat.1004967.s001

(TIF)

S2 Рис. Назначение резонансов для MvaT

ctd и додекамера 3AT в свободной и связанной форме.

2D 1 H- 15 N Спектры HSQC свободного (A) и ДНК-связанного MvaT ctd (B). Назначения обозначаются однобуквенным кодом аминокислоты и порядковым номером. Область отпечатка пальца 2D 1 H NOESY-спектры свободного (C) и связанного с белком (D) дуплекса ДНК 3AT.Пики H2’-H6 / H8 NOE в остатках помечены базовым типом и номером, а последовательная связь показана линиями.

https://doi.org/10.1371/journal.ppat.1004967.s002

(TIF)

S3 Рис. Влияние одиночной мутации на структуру MvaT

ctd .

Наложение 2D 1 H- 15 N Спектры HSQC R80A (A), K81A (B), K83A (C), K97A (D), N100A (E), K102A (F), K105A ( G) и K108A (H) (красный) с тем из WT MvaT ctd (черный).Для K83A сигналы NH плохо диспергированы, что указывает на то, что белковая складка K83A может быть изменена. Для других мутантов большинство затронутых сигналов NH происходит от остатков, близких к сайту мутации. Остатки, демонстрирующие значительные изменения химического сдвига, обозначены однобуквенным кодом аминокислоты и номером остатка.

https://doi.org/10.1371/journal.ppat.1004967.s003

(TIF)

S4 Фиг. Влияние одиночной мутации на связывание ДНК MvaT

ctd .

Наложение 2D 1 H- 15 N HSQC спектров с различным соотношением ДНК / белок для WT MvaT ctd (A), R80A (B), K81A (C), K97A (D), N100A (E ), K102A (F), K105A (G) и K108A (H).Отношения ДНК к белку: 0 (черный), 0,2 (красный), 0,4 (зеленый), 0,8 (синий), 1,2 (желтый), 1,6 (пурпурный) и 2,0 (голубой).

https://doi.org/10.1371/journal.ppat.1004967.s004

(TIF)

S5 Рис. Подгонка кривой ITC для WT MvaT

ctd и его мутантов.

Изотермы связывания калориметрического титрования WT MvaT ctd (A), R80A (B), K81A (C), K97A (D), N100A (E), K102A (F), K105A (G) и K108A ( H) к AT-богатой ДНК. (I) Изотерма связывания калориметрического титрования WT MvaT ctd с GC-богатой ДНК.Показаны термодинамические параметры, полученные в результате этих экспериментов по титрованию (вставка).

https://doi.org/10.1371/journal.ppat.1004967.s005

(TIF)

Благодарности

Мы благодарим Эмили Бекетт-Суард за создание слитых конструкций GST-MvaT, используемых в микрочипах связывания белков, и Блэра Гордона за предварительный анализ данных PBM. Мы благодарим Zhenhua Ming, Ruifeng Yao, Wei Tang и Hongduan Huang за их помощь в измерениях сродства связывания, а также Renate Hellmiss и Bryan McGuffie за помощь с иллюстрацией на рис.6.Все эксперименты ЯМР проводились в Пекинском центре ЯМР и в центре ЯМР Национального центра белковых наук при Пекинском университете.

Вклад авторов

Задумал и спроектировал эксперименты: PD TRH JL SLD WWN BX. Проведены эксперименты: ПД КАМ СЖ ГТ БД АЙ. Проанализированы данные: PD KAM GT BD TRH JL SLD WWN BX. Предоставленные реагенты / материалы / инструменты для анализа: JL SLD WWN BX. Написал бумагу: PD KAM GT SLD WWN BX.

Ссылки

  1. 1. Польз М.Ф., Альм Э.Дж., Ханаге В.П.Горизонтальный перенос генов и эволюция структуры популяции бактерий и архей. Тенденции Genet. 2013; 29: 170–175. pmid: 23332119
  2. 2. Crisp A, Boschetti C, Perry M, Tunnacliffe A, Micklem G. Экспрессия нескольких горизонтально приобретенных генов является отличительной чертой геномов как позвоночных, так и беспозвоночных. Genome Biol. 2015; 16: 50. pmid: 25785303
  3. 3. Baltrus DA. Изучение стоимости горизонтального переноса генов. Trends Ecol Evol. 2013; 28: 489–495.pmid: 23706556
  4. 4. Наварра WW, Макклелланд М, Либби SJ, Фанг ФК. Молчание ксеногенной ДНК за счет H-NS-облегчения латерального переноса генов в бактериях с помощью системы защиты, которая распознает чужеродную ДНК. Genes Dev. 2007; 21: 1456–1471. pmid: 17575047
  5. 5. Али СС, Ся Б., Лю Дж., Наварра, WW. Молчание чужеродной ДНК в бактериях. Curr Opin Microbiol. 2012; 15: 175–181. pmid: 22265250
  6. 6. Будет WR, Наварра WW, Фанг ФК. Интегральные схемы: как подавление транскрипции и противодействие молчанию способствует эволюции бактерий.Curr Opin Microbiol. 2015; 23: 8–13. pmid: 25461567
  7. 7. Сингх С.С., Сингх Н., Бонокора Р.П., Фицджеральд Д.М., Уэйд Дж. Т., Грейнджер, округ Колумбия. Широко распространенное подавление инициации внутригенной транскрипции с помощью H-NS. Genes Dev. 2014; 28: 214–219. pmid: 24449106
  8. 8. Coombes BK. Регуляторная эволюция на интерфейсе хозяин-патоген. Может J Microbiol. 2013; 59: 365–367. pmid: 23750949
  9. 9. Perez JC, Groisman EA. Функция фактора транскрипции и архитектура промотора управляют эволюцией бактериальных регулонов.Proc Natl Acad Sci U S. A. 2009; 106: 4319–4324. pmid: 19251636
  10. 10. Уилл В.Р., Бэйл Д. Х., Рид П.Дж., Либби С.Дж., Фанг ФК. Эволюционное расширение регулирующей сети за счет подавления звука. Nat Commun. 2014; 5: 5270. pmid: 25348042
  11. 11. Цвир I, Латифи Т., Перес Дж. К., Хуанг Х., Гройсман Э. А.. Промоутер архитектурного ландшафта регулона Salmonella PhoP. Mol Microbiol. 2012; 84: 463–485. pmid: 22435712
  12. 12. Zwir I, Yeo WS, Shin D, Latifi T, Huang H, Groisman EA.Бактериальный нуклеоид-ассоциированный белок отделяет уровни транскрипции от времени транскрипции. MBio. 2014; 5: e01485–01414. pmid: 25293763
  13. 13. Perez JC, Groisman EA. Эволюция схем регуляции транскрипции у бактерий. Клетка. 2009; 138: 233–244. pmid: 19632175
  14. 14. Muller CM, Dobrindt U, Nagy G, Emody L, Uhlin BE, Hacker J. Роль гистоноподобных белков H-NS и StpA в экспрессии детерминант вирулентности уропатогенных Escherichia coli.J Bacteriol. 2006; 188: 5428–5438. pmid: 16855232
  15. 15. Бартек И.Л., Вулхизер Л. К., Боун А.Д., Басараба Р.Дж., Джейкобс В.Р. мл., Ленертс А.Дж. и др. Mycobacterium tuberculosis Lsr2 — это глобальный регулятор транскрипции, необходимый для адаптации к изменению уровня кислорода и вирулентности. MBio. 2014; 5: e01106–01114. pmid: 24895305
  16. 16. Гордон Б.Р., Ли Й., Ван Л., Синцова А., ван Бакель Х., Тиан С. и др. Lsr2 представляет собой связанный с нуклеоидом белок, который нацелен на последовательности, богатые AT, и гены вирулентности у Mycobacterium tuberculosis.Proc Natl Acad Sci U S. A. 2010; 107: 5154–5159. pmid: 20133735
  17. 17. Navarre WW, Porwollik S, Wang Y, McClelland M, Rosen H, Libby SJ и др. Селективное подавление чужеродной ДНК с низким содержанием GC белком H-NS у Salmonella. Наука. 2006; 313: 236–238. pmid: 16763111
  18. 18. Goyard S, Bertin P. Характеристика Bph4, H-NS-подобного белка в Bordetella pertussis. Mol Microbiol. 1997; 24: 815–823. pmid:

    08

  19. 19. Тран Х.Дж., Хервен А. К., Винклер Л., Спретер Т., Беатрикс Б., Дерш П.Анализ RovA, регулятора транскрипции вирулентности Yersinia pseudotuberculosis, который действует через антирепрессию и прямую активацию транскрипции. J Biol Chem. 2005; 280: 42423–42432. pmid: 16257976
  20. 20. Эллисон Д.В., Миллер В.Л. H-NS репрессирует транскрипцию inv в Yersinia enterocolitica посредством конкуренции с RovA и взаимодействия с YmoA. J Bacteriol. 2006; 188: 5101–5112. pmid: 16816182
  21. 21. Banos RC, Pons JI, Madrid C, Juarez A. Глобальная модулирующая роль белка H-NS Yersinia enterocolitica.Микробиология. 2008; 154: 1281–1289. pmid: 18451036
  22. 22. Castang S, McManus HR, Turner KH, Dove SL. Члены семейства H-NS скоординированно действуют в условно-патогенных микроорганизмах. Proc Natl Acad Sci U S. A. 2008; 105: 18947–18952. pmid: 173
  23. 23. Валлет-Гели I, Донован К.Е., Фанг Р., Джунг Дж. К., Голубь С.Л. Подавление экспрессии гена чашки с переменной фазой с помощью H-NS-подобных белков у Pseudomonas aeruginosa. Proc Natl Acad Sci U S. A. 2005; 102: 11082–11087. pmid: 16043713
  24. 24.Кришнан Х. Х., Гош А., Пол К., Чоудхури Р. Влияние анаэробиоза на экспрессию факторов вирулентности в Vibrio cholerae. Заражение иммунной. 2004; 72: 3961–3967. pmid: 15213140
  25. 25. Ю. Р., ДиРита В. Дж. Регуляция экспрессии генов холерного вибриона с помощью ToxT включает как антирепрессию, так и стимуляцию РНК-полимеразы. Mol Microbiol. 2002; 43: 119–134. pmid: 11849541
  26. 26. Най МБ, Пфау Д.Д., Скорупски К., Тейлор Р.К. H-NS Vibrio cholerae подавляет экспрессию гена вирулентности на нескольких этапах регуляторного каскада ToxR.J Bacteriol. 2000; 182: 4295–4303. pmid: 10894740
  27. 27. Луккини С., Роули Дж., Голдберг, доктор медицины, Херд Д., Харрисон М., Хинтон Дж. H-NS опосредует подавление латерально приобретенных генов у бактерий. PLoS Pathog. 2006; 2: e81. pmid: 16933988
  28. 28. Али С.С., Су Дж., Рао С., Леунг А.С., Нгаи Д.Х. , Энсмингер А.В. и др. Выключение звука с помощью H-NS усиливало развитие сальмонеллы. PLoS Pathog. 2014; 10: e1004500. pmid: 25375226
  29. 29. Gordon BR, Li Y, Cote A, Weirauch MT, Ding P, Hughes TR и др.Структурная основа распознавания AT-богатой ДНК неродственными ксеногенными белками сайленсинга. Proc Natl Acad Sci U S. A. 2011; 108: 10690–10695. pmid: 21673140
  30. 30. Castang S, Dove SL. Олигомеризация высокого порядка необходима для функционирования члена семейства H-NS MvaT в Pseudomonas aeruginosa. Mol Microbiol. 2010; 78: 916–931. pmid: 20815825
  31. 31. Лим CJ, Lee SY, Kenney LJ, Yan J. Формирование нуклеопротеиновых филаментов является структурной основой подавления гена H-NS бактериального белка.Sci Rep.2012; 2: 509. pmid: 22798986
  32. 32. Winardhi RS, Fu W, Castang S, Li Y, Dove SL, Yan J. Для члена семейства H-NS MvaT требуется олигомеризация более высокого порядка, чтобы сформировать блокирующий гены нуклеопротеиновый филамент. Nucleic Acids Res. 2012; 40: 8942–8952. pmid: 22798496
  33. 33. Ку И., Лим С. Дж., Ван Ю. Р., Лю Дж., Ян Дж. Механизм организации ДНК с помощью белка Lsr2 Mycobacterium tuberculosis. Nucleic Acids Res. 2013; 41: 5263–5272. pmid: 23580555
  34. 34.Котлайич М.В., Хрон Д.Р., Будро Б.А., Сан З., Любченко Ю.Л., Ландик Р. Мостиковые нити гистоноподобного нуклеоида, структурирующего белок, приостанавливают РНК-полимеразу и способствуют терминации у бактерий. Элиф. 2015; 4. pmid: 25594903
  35. 35. Sette M, Spurio R, Trotta E, Brandizi C, Brandi A, Pon CL и др. Последовательно-специфическое распознавание ДНК С-концевым доменом нуклеоид-ассоциированного белка H-NS. J Biol Chem. 2009; 284: 30453–30462. pmid: 19740756
  36. 36. Синдо Х., Иваки Т., Иеда Р., Курумидзака Х., Уегучи С., Мизуно Т. и др.Структура раствора ДНК-связывающего домена нуклеоид-ассоциированного белка H-NS из Escherichia coli. FEBS Lett. 1995; 360: 125–131. pmid: 7875316
  37. 37. Шиндо Х., Охнуки А., Гинба Х., Катох Э., Уегучи С., Мидзуно Т. и др. Идентификация ДНК-связывающей поверхности белка H-NS из Escherichia coli с помощью гетероядерной ЯМР-спектроскопии. FEBS Lett. 1999; 455: 63–69. pmid: 10428473
  38. 38. Cordeiro TN, Schmidt H, Madrid C, Juarez A, Bernado P, Griesinger C и др.Непрямое считывание ДНК белком, родственным H-NS: структура ДНК-комплекса С-концевого домена Ler. PLoS Pathog. 2011; 7: e1002380. pmid: 22114557
  39. 39. Diggle SP, Winzer K, Lazdunski A, Williams P, Camara M. Расширение кворума в Pseudomonas aeruginosa: MvaT и регуляция производства N-ацилгомосеринового лактона и экспрессии гена вирулентности. J Bacteriol. 2002; 184: 2576–2586. pmid: 11976285
  40. 40. Валле I, Диггл С.П., Стейси Р.Э., Камара М., Вентр I, Лори С. и др.Формирование биопленок у Pseudomonas aeruginosa: кластеры генов фимбриальной чашечки контролируются транскрипционным регулятором MvaT. J Bacteriol. 2004; 186: 2880–2890. pmid: 150
  41. 41. Tendeng C, Soutourina OA, Danchin A, Bertin PN. Белки MvaT в Pseudomonas spp .: новый класс H-NS-подобных белков. Микробиология. 2003; 149: 3047–3050. pmid: 14600217
  42. 42. Вестфолл Л.В., Карти Н.Л., Лейланд Н., Куан П., Колмер-Хамуд Д.А., Хамуд А.Н. Мутация mvaT модифицирует экспрессию оперона mexEF-oprN, оперирующего множественным лекарственным оттоком Pseudomonas aeruginosa.FEMS Microbiol Lett. 2006; 255: 247–254. pmid: 16448502
  43. 43. Castang S, Dove SL. Основа существенности членов семейства H-NS у Pseudomonas aeruginosa. J Bacteriol. 2012; 194: 5101–5109. pmid: 22821971
  44. 44. Бергер М.Ф., Филиппакис А.А., Куреши А.М., Хе Ф.С., Эстеп П.В. 3-й, Булык М.Л. Компактные универсальные ДНК-микрочипы для всестороннего определения специфичности сайтов связывания транскрипционных факторов. Nat Biotechnol. 2006; 24: 1429–1435. pmid: 16998473
  45. 45.Лам К.Н., ван Бакель Х., Кот АГ, ван дер Вен А, Хьюз Т. Р. Специфичность последовательности получается из большинства модульных массивов цинковых пальцев C2h3. Nucleic Acids Res. 2011; 39: 4680–4690. pmid: 21321018
  46. 46. Бадис Г., Бергер М.Ф., Филиппакис А.А., Талукдер С., Герке А.Р., Джегер С.А. и др. Разнообразие и сложность распознавания ДНК факторами транскрипции. Наука. 2009; 324: 1720–1723. pmid: 19443739
  47. 47. Бергер М.Ф., Бадис Г., Герке А.Р., Талукдер С., Филиппакис А.А., Пена-Кастильо Л. и др.Изменения в связывании гомеодоменной ДНК выявлены с помощью анализа предпочтений последовательностей с высоким разрешением. Клетка. 2008; 133: 1266–1276. pmid: 18585359
  48. 48. Лоусон CL, Берман HM. Непрямое считывание белками последовательности ДНК. В: Райс П.Л., Коррелл С.К., редакторы. Взаимодействие белков и нуклеиновых кислот: структурная биология. Кембридж (Великобритания): RSC Publishing; 2008. с. 66–90.
  49. 49. Харан Т.Э., Моханти У. Уникальная структура А-трактов и внутреннее изгибание ДНК. Q Rev Biophys.2009; 42: 41–81. pmid: 19508739
  50. 50. Чжоу Т., Ян Л., Лу И, Дрор И., Дантас Мачадо А.С., Гане Т. и др. DNAshape: метод высокопроизводительного прогнозирования структурных особенностей ДНК в геномном масштабе. Nucleic Acids Res. 2013; 41: W56–62. pmid: 23703209
  51. 51. Реттиг М., Германн М.В., Ван С., Уилсон В.Д. Молекулярная основа зависимого от последовательности индуцированного изгиба ДНК. Chembiochem. 2013; 14: 323–331. pmid: 23355266
  52. 52. Макдональд Д., Герберт К., Чжан Х, Пологруто Т., Лу П.Структура решения изгиба ДНК А-тракта. J Mol Biol. 2001; 306: 1081–1098. pmid: 11237619
  53. 53. Stellwagen E, Peters JP, Maher LJ 3rd, Stellwagen NC. А-тракты ДНК не искривлены в растворах, содержащих высокие концентрации одновалентных катионов. Биохимия. 2013; 52: 4138–4148. pmid: 23675817
  54. 54. Jen-Jacobson L, Engler LE, Jacobson LA. Структурные и термодинамические стратегии для сайт-специфичных ДНК-связывающих белков. Структура. 2000; 8: 1015–1023.pmid: 11080623
  55. 55. Привалов П.Л., Драган А.И., Крейн-Робинсон С., Бреслауэр К.Дж., Ремета Д.П., Минетти, Калифорния. Что заставляет белки попадать в большие или второстепенные бороздки ДНК? J Mol Biol. 2007; 365: 1–9. pmid: 17055530
  56. 56. Рутенбург AJ, Ли Х, Patel DJ, Allis CD. Многовалентное взаимодействие модификаций хроматина за счет связанных связывающих модулей. Nat Rev Mol Cell Biol. 2007; 8: 983–994. pmid: 18037899
  57. 57. Bouffartigues E, Пряжка M, Badaut C, Travers A, Rimsky S.Кооперативное связывание H-NS с сайтами с высокой аффинностью в регуляторном элементе приводит к подавлению транскрипции. Nat Struct Mol Biol. 2007; 14: 441–448. pmid: 17435766
  58. 58. Рутенбург AJ, Allis CD, Wysocka J. Метилирование лизина 4 на гистоне h4: сложность записи и чтения одной эпигенетической метки. Mol Cell. 2007; 25: 15–30. pmid: 17218268
  59. 59. Winardhi RS, Gulvady R, Mellies JL, Yan J. Локус регулятора, кодирующего удаление энтероцитов (Ler) патогенной Escherichia coli, конкурирует с гистоноподобным структурирующим нуклеоид белком (H-NS) посредством некооперативного связывания ДНК.J Biol Chem. 2014; 289: 13739–13750. pmid: 24668810
  60. 60. Chovancova E, Pavelka A, Benes P, Strnad O, Brezovsky J, Kozlikova B, et al. CAVER 3.0: инструмент для анализа транспортных путей в динамических белковых структурах. PLoS Comput Biol. 2012; 8: e1002708. pmid: 23093919
  61. 61. Рохс Р., Джин Икс, Вест С.М., Джоши Р., Хониг Б., Манн Р.С. Истоки специфичности распознавания белок-ДНК. Анну Рев Биохим. 2010; 79: 233–269. pmid: 20334529
  62. 62.Слэттери М., Чжоу Т., Ян Л., Дантас Мачадо А.С., Гордан Р., Рохс Р. Отсутствие простого кода: как факторы транскрипции читают геном. Trends Biochem Sci. 2014; 39: 381–399. pmid: 25129887
  63. 63. Huth JR, Bewley CA, Nissen MS, Evans JN, Reeves R, Gronenborn AM и др. Структура раствора комплекса HMG-I (Y) -DNA определяет новый архитектурный мотив связывания малых бороздок. Nat Struct Biol. 1997; 4: 657–665. pmid: 9253416
  64. 64. Лоуренс Дж. Г., Охман Х.Молекулярная археология генома Escherichia coli. Proc Natl Acad Sci U S. A. 1998; 95: 9413–9417. pmid: 9689094
  65. 65. Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, Bax A. NMRPipe: система многомерной спектральной обработки, основанная на конвейерах UNIX. J Biomol ЯМР. 1995; 6: 277–293. pmid: 8520220
  66. 66. Джонсон Б.А., Блевинс Р.А. ЯМР View: компьютерная программа для визуализации и анализа данных ЯМР. J Biomol ЯМР. 1994; 4: 603–614. pmid: 220
  67. 67.Шен Y, Делаглио Ф., Корнилеску Дж., Бакс А. TALOS +: гибридный метод для предсказания углов скручивания остова белка по химическим сдвигам ЯМР. J Biomol ЯМР. 2009; 44: 213–223. pmid: 19548092
  68. 68. Herrmann T, Guntert P, Wuthrich K. Определение структуры ЯМР белка с автоматическим определением NOE с использованием нового программного обеспечения CANDID и алгоритма динамики торсионного угла DYANA. J Mol Biol. 2002; 319: 209–227. pmid: 12051947
  69. 69. Дагган Б.М., Легге ГБ, Дайсон Г.Дж., Райт ЧП.SANE (Structure Assisted NOE Evaluation): автоматизированный подход, основанный на модели, для присвоения NOE. J Biomol ЯМР. 2001; 19: 321–329. pmid: 11370778
  70. 70. Дело DA, Cheatham TE 3rd, Darden T., Gohlke H, Luo R, Merz KM Jr. и др. Программы биомолекулярного моделирования Amber. J. Comput Chem. 2005; 26: 1668–1688. pmid: 16200636
  71. 71. Бак-Кентоп Б.А., Стэнфилд Р.Л., Экиерт Д.К., Мартинес-Ямут М.А., Дайсон Г.Дж., Уилсон И.А. и др. Молекулярная основа распознавания метилированных и специфических последовательностей ДНК белком «цинковый палец» Kaiso.Proc Natl Acad Sci U S. A. 2012; 109: 15229–15234. pmid: 22949637
  72. 72. Ласковски Р.А., Руллманн Дж. А., Макартур М. В., Каптейн Р., Торнтон Дж. М.. AQUA и PROCHECK-NMR: программы для проверки качества белковых структур, решаемые методом ЯМР. J Biomol ЯМР. 1996; 8: 477–486. pmid:

    63
  73. 73. Blanchet C, Pasi M, Zakrzewska K, Lavery R. CURVES + веб-сервер для анализа и визуализации параметров спирали, скелета и бороздки структур нуклеиновых кислот. Nucleic Acids Res.2011; 39: W68–73. pmid: 21558323
  74. 74. Weirauch MT, Yang A, Albu M, Cote AG, Montenegro-Montero A, Drewe P и др. Определение и заключение о специфичности последовательности фактора транскрипции эукариот. Клетка. 2014; 158: 1431–1443. pmid: 25215497
  75. 75. Гибсон Д.Г., Янг Л., Чуанг Р.Й., Вентер Дж.С., Хатчисон, Калифорния, 3-й, Смит Х.О. Ферментативная сборка молекул ДНК до нескольких сотен килобаз. Нат методы. 2009; 6: 343–345. pmid: 19363495
  76. 76. Уикхэм Х.ggplot2: элегантная графика для анализа данных: Springer; 2009.
  77. 77. Дав С.Л., Хохшильд А. Бактериальная двугибридная система, основанная на активации транскрипции. Методы Мол биол. 2004; 261: 231–246. pmid: 15064462

Наконец-то прибыло широкое признание для Array

Несмотря на изобретение и лицензирование экспериментальных малых молекул в течение более 20 лет, Array Biopharma серьезно заинтересовалась инвесторами только в последние 18 месяцев. Объявленное сегодня предложение Pfizer за компанию на сумму 11,4 миллиарда долларов показывает, что промышленность также наконец обратила на это внимание.

С рыночной комбинацией рака и значительным портфелем роялти привлекательность Array понятна. Что еще более удивительно, так это цена, которая была необходима для заключения сделки: на 62% выше цены акций Array на момент закрытия торгов в пятницу премия выглядит еще значительнее, если учесть, что акции компании уже удвоились в цене в этом году.

Pfizer, конечно, может себе это позволить, хотя сегодня утром во время телефонного разговора с инвесторами фармацевтический гигант был засыпан вопросами о том, как компания пришла к такой оценке.Эти запросы были в основном отклонены, и неопределенность компании показывает, что многие движущиеся части Array по-прежнему очень трудно оценить.

Deal драйверы

Руководители Pfizer описали три основных фактора стоимости сделки: комбинация Braftovi / Mektovi, получившая одобрение в отношении меланомы в прошлом году, портфель роялти, подробно описанный ниже, и исследовательская платформа, которая, по словам Pfizer, будет сохраняться как независимая организация.

Следует предположить, что Брафтови / Мектови был основным источником ценности здесь.В то время как Pfizer дал понять, что меланома будет по-прежнему в центре внимания, эта комбинация, которая занимает третье место на рынке этого типа опухоли после Novartis и Roche, долгое время считалась конечной франшизой.

Отсюда решение Array сосредоточиться на колоректальном раке, вызванном Braf, — вдохновляющая стратегия, которая вполне могла быть ответственна за пробуждение интереса у поклонника ( Колоректальный рак может позволить Array наконец остаться в одиночестве 22 мая 2019 г.

Именно здесь Braftovi / Mektovi недавно одержали победу в испытании Beacon, и потенциал в этой ситуации во многом повлиял на недавнюю цену акций Array.Хотя прогноз Pfizer о продажах блокбастеров в этом контексте отчасти можно рассматривать как оправдание закупочной цены, аналитики также довольно оптимистичны. EvaluatePharma Консенсусное мнение компании о продажах в 2024 году составит 702 миллиона долларов в отношении колоректального рака.

Тем не менее, многое зависит от доказательств эффективности в более ранних условиях, и все взоры прикованы к первому этапу исследования Anchor II фазы, которое завершится в начале следующего года. Энди Шмельц, генеральный менеджер Pfizer Oncology, сказал во время телеконференции, что этот маяк вселил надежду на столь же надежные результаты; предположительно компания также надеется, что данные достаточно убедительны, чтобы поддержать ускоренное одобрение.

Pfizer также должен надеяться на победу в испытаниях Mektovi в сочетании с ингибиторами контрольных точек; успех здесь потенциально может иметь большое значение для будущего рыночного потенциала. Три исследования продолжаются; Первым, кто сообщил, в любое время сейчас, является комбинация с Opdivo Bristol-Myers Squibb для пациентов с колоректальным раком со стабильной микросателлитной болезнью (MSS) и мутацией Ras.

Брафтови / Мектови испытания для наблюдения
Пробная пр. Детали Срок сдачи
Анкер (NCT03693170) Брафтови + Мектови + Эрбитукс 1L мутант Braf mCRC Начало 2020 г.
NCT03271047 Мектови + Опдиво или Опдиво + Ервой mCRC с заболеванием MSS и мутацией Ras июн 2019
МК-3475-651 (NCT03374254) Keytruda + Mektovi +/- Chemo мCRC ноя 2021
NCT03637491 Бавенсио + Мектови +/- Талзенна Ras-мутантные солидные опухоли июл 2022
Примечания: mCRC = метастатический колоректальный рак; MSS = микроспутник стабильный.Источник: Clinicaltrials.gov и презентации компаний.

В конце концов, для Брафтови / Мектови многое еще предстоит сделать. То же самое можно сказать и о бизнесе потоков роялти Array, который включает в себя несколько очень многообещающих агентов, хотя большинство из них еще не прошли серьезное тестирование.

В то время как Array, безусловно, преуспел в изобретении и лицензировании новых агентов, многие из его сделок были заключены на ранней стадии, что послужило причиной большой критики бизнес-модели ( Неужели Array, придерживаясь вязания, слишком много отказался ?, январь 31 января 2019 г. ).Таким образом, причитающиеся гонорары невелики, и хотя они представляют собой чистую прибыль, эти проекты, несомненно, должны стать чрезвычайно успешными, чтобы сдвинуть иглу в Pfizer.

Фармацевтический гигант предсказал, что поток роялти Array станет самостоятельным в середине 2020-х годов; опять же, руководители отказались назвать крупных вкладчиков, но, по-видимому, активы Loxo должны быть высоко оценены.

Приносить домой бекон? Выбранные активы Array, полностью лицензированные и принадлежащие
пр. Статус Лицензия на Роялти
Мектови (биниметиниб) Утверждено для лечения меланомы, фаза III в CRC Пьер Фабр и Оно Пьер Фабр: гонорары двузначные, 20-35%
Брафтови (энкорафениб) Оно: гонорары двузначные, 22-25%
Витракви Утверждено Байер (Loxo) Однозначное число от среднего до высокого
Ганово (данопревир) Утверждено (Китай) Рош (Intermune) ?
LOXO-292 (селперкатиниб) Фаза II (регистрация) Лилли (Loxo) Однозначное число от среднего до высокого
Селуметиниб Фаза II (регистрация) Астразенека ?
Тукатиниб (ONT-380) Фаза II (регистрация) Сиэтл Генетикс (Каскадский) До двузначного числа
Ипатасертиб Фаза III Рош (Genentech) ?
ARRY-797 Фаза III N / A (в полной собственности) НЕТ
Варлитиниб Фаза II / III Аслан Младший двузначный
ARRY-382 Фаза II N / A (в полной собственности) НЕТ
Мотолимод Фаза II Celgene (Ventirx) ?
LOXO-195 Фаза I / II Байер (Loxo) Однозначное число от среднего до высокого
MRTX849 Фаза I / II Мирати Однозначные числа от старшего до среднего подросткового возраста
AK-1830 / ARRY-954 Фаза I Asahi Kasei Pharma До двузначного числа
Источник: данные SEC.

Наконец, руководство Pfizer высоко оценило исследовательский механизм Array, который обещал ежегодно вводить в клинику одно новое соединение. Один из них может появиться даже в этом году — хотя то, что может быть целью, держалось в секрете.

Конечно, можно взглянуть на эту сделку по-другому: Pfizer заплатила 11,4 млрд долларов за еще один фактор роста онкологии, а богатая крупная фармацевтическая компания всегда рада заплатить за новую тему для разговора. Несомненно, что одна группа акционеров сегодня будет в восторге.После многих лет, когда семейное серебро распродается по дешевке, инвесторы Array наконец-то получили настоящую зарплату.

Признание

— Rich Cutler Sound Mix + Design

Обладая более чем 30-летним опытом, Rich Cutler является аудиомикшером, номинированным на премию Эмми, и является залогом успеха. В условиях меняющегося рынка он обладает способностью обрабатывать обширный звуковой дизайн, а также микшировать для широкого спектра потребностей. Рич приносит с собой навыки, необходимые для успешного управления проектами, которые позволят выполнить задачи в самые напряженные сроки.Качество всегда превыше всего — без компромиссов. Одним из многих аспектов талантов Рича, которые отличают его от других, являются его сильные стороны в технических аспектах управления успешным аудиооборудованием в сочетании с сильными знаниями в области поиска и устранения неисправностей. Его компания Rich Cutler Sound Mix & Design, Inc. была основана в 2007 году и надеется на продолжение отношений и налаживание новых, в которых цель пути — удовлетворение потребностей клиентов и качество продукции.

Это жизнь с Лизой Линг: серия , звукорежиссер, микшер для перезаписи, 2017

Место преступления: серия , звуковой дизайнер, микшер для перезаписи, 2017

Food Paradise: серия , звук Дизайнер, перезаписывающий микшер, 2017

We Will Rise Documentary : звуковой дизайнер, перезаписывающий микшер, 2016

Trisha’s Southern Kitchen : перезаписывающий микшер, 2016

Car Stars Web Series : звуковой дизайнер , Микшер для перезаписи, 2016

Steven Be Web Series : звукорежиссер, микшер для перезаписи, 2016

Прямой эфир из Линкольн-центра : микшер для перезаписи, 2013-2016

Линкольн-центр в кино : микшер перезаписи, 2015

документальный фильм Ньюмана : звукорежиссер, микшер перезаписи, 2015

круиз: художественный фильм, редактор диалогов, звукорежиссер, микшер перезаписи, компания mpleted 2016

50 Shades of Greige : короткометражка, звуковой дизайнер, микшер для перезаписи, 2016

Kosher Soul : телесериал, микшер для перезаписи, 2015

The New Yorker Presents : документальный сериал , Звукорежиссер, микшер для перезаписи, 2015

Over My Dead Body : телесериал, пост-продакшн аудио, 2014

Like Sunday, Like Rain : Sound Design and Mix, 2014

The Approval Matrix : сериал, микшер для перезаписи, 2014

Spartan Race Reebok : мини-сериал, микшер для перезаписи, 2014

Trust Me, I’m a Lifeguard : Short, Sound Mixer, 2013

Импровизация: 50 лет за кирпичной стеной : телевизионный документальный фильм, аудиомикс, 2012-2013

Oddities : телесериал, микшер для перезаписи, 2013

Playing With Fire : телесериал, пост Аудиомикшер, 2013

Comic Book Men : TV Series, Post Audio Mixer, 2012-2013

Kimberly’s Simply Southern : TV Series, Post Audio Mixer, Sound Designer 2012-2013

Fix My Family : TV Series, Post Audio Mixer , 2013

Подсчет автомобилей : телесериал, микшер для перезаписи звука, 2012

заброшенный : телесериал, микшер для перезаписи звука, 2012

мама-подросток : телесериал, микшер для перезаписи звука , 2012

Empire Girls : Julissa & Adrienne : TV Series, Post Audio Mixer, 2012

Oddities San Francisco : TV Series, Sound Re-Recording Mixer, 2012

Cajun Pawn Stars : TV Series, микшер для перезаписи звука, 2012

Truck Stop Missouri : телесериал, микшер для перезаписи звука, 2012

Oddities : телесериал, микшер для перезаписи звука, 2012-2013

Girlfriend Confidenti al: LA : ТВ-фильм, Post Sound Mixer, 2012

Birds of Brooklyn : Short, Sound Mixer, 2012

Monster in-Laws : TV Series, Post Audio Mixer, 2011

Fashion Hunters : TV Series, Post Audio Mixer, 2011

I Do Over : TV Series, Post Audio Mixer, 2011

Сохранено : Документальные сериалы, Post Audio Mixer, 2011

Не перышко, а точка : Документальный, Post Audio Mixer, 2011

An American Life: The Journey from Violence to Hope : Documentary, Post Audio Mixer, 2011

Detour : Звукорежиссер, звуковой редактор, микшер для перезаписи звука, 2011

The Haunted : документальный сериал, Post Audio Mixer, 2010-2011

Psychic Kids: Children of the Paranormal : документальный сериал, Post Audio Mixer, 2010

My Life in Food : TV Series, Post Audio M ixer, 2010

Эй, смотрите этот : Видеофильм, микшер для перезаписи звука

Обезьяна, сними маску! : Короткий, перезаписывающий микшер

Fall, Short : звуковой редактор, перезаписывающий микшер

Last Day of Summer : редактор диалогов, звуковой дизайнер, микшер для перезаписи звука, 2009

Сток Дракулы : Документальный фильм, Звук спецэффектов, 2009

D.E.A. : сериал, звукорежиссер — 9 эпизодов-2009, микшер для перезаписи звука — 9 эпизодов-2009

ожидание Армагеддона : документальный фильм, звуковой микшер, 2009

No Dog Left Behind : короткометражный документальный фильм, публикация Audio Mixer, Sound Designer, 2009

Sweet Nothing : Short, Re-Recording Mixer, 2009

I Love the New Millennium : TV Mini-series, Post Audio Mixer, 2008

Karma Police : Сообщение Audio Mixer, 2008

The Gamekillers : сериал, Post Audio Mixer, 2007

Iconoclasts : Документальный сериал, Post Audio Mixer, 2005–2007

Wade in the Water : Children, Documentary, Post Audio Mixer, 2007

Mad Men : TV Pilot, Re-Recording Mixer, Dialogue Editor, Sound Designer, 2007

Rockaway : Dialog Editor, 2007

Fast Cars and Superstars: The Gillette Young Guns Celebrity Race : телесериал, звукорежиссер, микшер для перезаписи, 2007

The Polymath, или Жизнь и мнения Сэмюэля Р.Делани, Джентльмен : документальный фильм, микшер Post Audio, 2007

I’m No Stud : Short, Post Audio Mixer, 2007

Sportsfan : телевизионный документальный фильм, микшер для перезаписи, 2006

Black and White : Портрет Шона Комбса ,: телевизионный документальный фильм, перезаписывающий микшер, 2006

Пластиковые катастрофы : телевизионный документальный фильм, пост-аудиомикшер, 2006

Десять дней, которые неожиданно изменили Америку : документальный телесериал, пост-аудио Mixer, 2006

Fade To Black : Sound Editor, 2005

Gamekillers : TV Movie and Series, Post Audio Mixer, Sound Designer, 2005-2006

Fuse Hot 97 Summer Jam : Музыкальный редактор, Post Audio Mixer, 2004

Battlegrounds: King of the Court : документальный сериал, Post Audio Mixer, 2004-2005

Super Bowl XXXVIII : Sound Designer, Post Audio Mixer, 2004

The NFL Today : телесериал, звукорежиссер, микшер Post Audio, 2000-2004

SportsCentury : величайшие атлеты века : телесериал, перезаписываемый эпизод Mixer-1, 2002

Darryl Strawberry : Re — Recording Mixer, 2002

History Undercover: Road Map to Pearl Harbor : ТВ документальный фильм, микшер для перезаписи, 2001

ABC Weekend Specials : сериал, эпизод Post Audio Mixer-1, 1995

Crash Curiousaurus : Post Audio Mixer, 1995

Кто этот человек? : Assistant Dialogue Editor — в титрах не указан, 1993

.

Добавить комментарий